EMAIL THIS PAGE TO A FRIEND

YPEL3

yippee-like 3 (Drosophila)

UniProtKB ID: P61236, Q65Z99, Q86VK6, Q9BSJ4, Q9CQB6
Gene ID:
Mouse(66090) yippee-like 3 (Drosophila)
Rat(293491) yippee-like 3 (Drosophila)
Zebrafish(368214) yippee-like 3
domestic cat(101080601) yippee-like 3 (Drosophila)
dog(100687196) yippee-like 3 (Drosophila)
cow(787498) yippee-like 3 (Drosophila)
sheep(101115250) yippee-like 3 (Drosophila)
domestic guinea pig(100726240) yippee-like 3 (Drosophila)
naked mole-rat(101699744) yippee-like 3 (Drosophila)
139 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301810 Anti-YPEL3 affinity isolated antibody human, mouse
immunohistochemistry pricing
HPA030501 Anti-YPEL3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB3500712 Anti-YPEL3 antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunocytochemistry, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031477 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031477 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031477 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025347 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025347 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025347 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031477 Rosetta Predictions human pricing
XM_001080016 Rosetta Predictions rat pricing
XM_215057 Rosetta Predictions rat pricing
NM_025347 Rosetta Predictions mouse pricing
NM_026875 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031477 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031838 predicted 850
2 SASI_Hs01_00031839 predicted 829
3 SASI_Hs01_00031840 predicted 1294
4 SASI_Hs01_00031841 predicted 971
5 SASI_Hs02_00358908 predicted 1294
6 SASI_Hs01_00031843 predicted 873
7 SASI_Hs01_00031844 predicted 847
8 SASI_Hs02_00358909 predicted 858
9 SASI_Hs01_00031847 predicted 1147
10 SASI_Hs02_00358910 predicted 1035
11 SASI_Hs01_00031842 predicted 983
12 SASI_Hs01_00031845 predicted 885
13 SASI_Hs01_00031846 predicted 711
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080016 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00366248 predicted 489
2 SASI_Rn02_00366249 predicted 323
3 SASI_Rn02_00366250 predicted 368
4 SASI_Rn02_00366251 predicted 737
5 SASI_Rn02_00366252 predicted 695
6 SASI_Rn02_00366253 predicted 546
7 SASI_Rn02_00366254 predicted 832
8 SASI_Rn02_00366255 predicted 694
9 SASI_Rn02_00366256 predicted 731
10 SASI_Rn02_00366257 predicted 829
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_215057 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375777 predicted 558
2 SASI_Rn02_00375778 predicted 401
3 SASI_Rn02_00375779 predicted 444
4 SASI_Rn02_00375780 predicted 805
5 SASI_Rn02_00375781 predicted 764
6 SASI_Rn02_00375782 predicted 617
7 SASI_Rn02_00375783 predicted 901
8 SASI_Rn02_00375784 predicted 763
9 SASI_Rn02_00375785 predicted 800
10 SASI_Rn02_00375786 predicted 901
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025347 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00328007 predicted 402
2 SASI_Mm01_00095175 predicted 606
3 SASI_Mm02_00328008 predicted 417
4 SASI_Mm02_00328009 predicted 458
5 SASI_Mm02_00328010 predicted 516
6 SASI_Mm01_00095183 predicted 599
7 SASI_Mm02_00328011 predicted 412
8 SASI_Mm02_00328012 predicted 553
9 SASI_Mm02_00328013 predicted 455
10 SASI_Mm02_00328014 predicted 500
11 SASI_Mm01_00095174 predicted 666
12 SASI_Mm01_00095176 predicted 673
13 SASI_Mm01_00095177 predicted 670
14 SASI_Mm01_00095178 predicted 664
15 SASI_Mm01_00095179 predicted 670
16 SASI_Mm01_00095180 predicted 674
17 SASI_Mm01_00095181 predicted 614
18 SASI_Mm01_00095182 predicted 669
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026875 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00331114 predicted 501
2 SASI_Mm01_00118134 predicted 705
3 SASI_Mm02_00331115 predicted 516
4 SASI_Mm02_00331116 predicted 555
5 SASI_Mm02_00331117 predicted 608
6 SASI_Mm01_00118142 predicted 706
7 SASI_Mm02_00331118 predicted 517
8 SASI_Mm02_00331119 predicted 646
9 SASI_Mm02_00331120 predicted 551
10 SASI_Mm02_00331121 predicted 601
11 SASI_Mm01_00118133 predicted 736
12 SASI_Mm01_00118135 predicted 744
13 SASI_Mm01_00118136 predicted 739
14 SASI_Mm01_00118137 predicted 736
15 SASI_Mm01_00118138 predicted 739
16 SASI_Mm01_00118139 predicted 737
17 SASI_Mm01_00118140 predicted 688
18 SASI_Mm01_00118141 predicted 740
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031477
VALIDATED
YPEL3 MISSION shRNA Bacterial Glycerol Stock
yippee-like 3 (Drosophila)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166935    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031477.3-1140s1c1
Sequence:CCGGGAAGTACATCATTGAACTCAACTCGAGTTGAGTTCAATGATGTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172555    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031477.3-874s1c1
Sequence:CCGGGATGATTGTCACCGGAGGTATCTCGAGATACCTCCGGTGACAATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172387    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031477.3-862s1c1
Sequence:CCGGCAGGCCTACTTGGATGATTGTCTCGAGACAATCATCCAAGTAGGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243057    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031477.4-1303s21c1
Sequence:CCGGCGGATCTAGCTCCTGTATATACTCGAGTATATACAGGAGCTAGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_031477.4-1154s21c1
Sequence:CCGGGAACTCAACCACATGATCAAACTCGAGTTTGATCATGTGGTTGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031477.4-1116s21c1
Sequence:CCGGAGAGCAGCCAGAAGTACAAAGCTCGAGCTTTGTACTTCTGGCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_031477.4-862s21c1
Sequence:CCGGTCAGGCCTACTTGGATGATTGCTCGAGCAATCATCCAAGTAGGCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031477.4-1070s21c1
Sequence:CCGGGAGAACTGCAAGACCACTTTGCTCGAGCAAAGTGGTCTTGCAGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031477
VALIDATED
YPEL3 MISSION shRNA shRNA Plasmid DNA
yippee-like 3 (Drosophila)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166935    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031477.3-1140s1c1
Sequence:CCGGGAAGTACATCATTGAACTCAACTCGAGTTGAGTTCAATGATGTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172555    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031477.3-874s1c1
Sequence:CCGGGATGATTGTCACCGGAGGTATCTCGAGATACCTCCGGTGACAATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172387    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031477.3-862s1c1
Sequence:CCGGCAGGCCTACTTGGATGATTGTCTCGAGACAATCATCCAAGTAGGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243057    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031477.4-1303s21c1
Sequence:CCGGCGGATCTAGCTCCTGTATATACTCGAGTATATACAGGAGCTAGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_031477.4-1154s21c1
Sequence:CCGGGAACTCAACCACATGATCAAACTCGAGTTTGATCATGTGGTTGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031477.4-1116s21c1
Sequence:CCGGAGAGCAGCCAGAAGTACAAAGCTCGAGCTTTGTACTTCTGGCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_031477.4-862s21c1
Sequence:CCGGTCAGGCCTACTTGGATGATTGCTCGAGCAATCATCCAAGTAGGCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031477.4-1070s21c1
Sequence:CCGGGAGAACTGCAAGACCACTTTGCTCGAGCAAAGTGGTCTTGCAGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031477
VALIDATED
YPEL3 MISSION shRNA Lentiviral Transduction Particles
yippee-like 3 (Drosophila)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166935    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031477.3-1140s1c1
Sequence:CCGGGAAGTACATCATTGAACTCAACTCGAGTTGAGTTCAATGATGTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172555    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031477.3-874s1c1
Sequence:CCGGGATGATTGTCACCGGAGGTATCTCGAGATACCTCCGGTGACAATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172387    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031477.3-862s1c1
Sequence:CCGGCAGGCCTACTTGGATGATTGTCTCGAGACAATCATCCAAGTAGGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243057    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031477.4-1303s21c1
Sequence:CCGGCGGATCTAGCTCCTGTATATACTCGAGTATATACAGGAGCTAGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_031477.4-1154s21c1
Sequence:CCGGGAACTCAACCACATGATCAAACTCGAGTTTGATCATGTGGTTGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031477.4-1116s21c1
Sequence:CCGGAGAGCAGCCAGAAGTACAAAGCTCGAGCTTTGTACTTCTGGCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_031477.4-862s21c1
Sequence:CCGGTCAGGCCTACTTGGATGATTGCTCGAGCAATCATCCAAGTAGGCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031477.4-1070s21c1
Sequence:CCGGGAGAACTGCAAGACCACTTTGCTCGAGCAAAGTGGTCTTGCAGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025347
VALIDATED
YPEL3 MISSION shRNA Bacterial Glycerol Stock
yippee-like 3 (Drosophila)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200762    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025347.1-460s1c1
Sequence:CCGGGAAATATGAGCAAGCCTTTGACTCGAGTCAAAGGCTTGCTCATATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025347.1-424s1c1
Sequence:CCGGCATCCACTGTGAGAACTGCAACTCGAGTTGCAGTTCTCACAGTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025347.1-523s1c1
Sequence:CCGGCAACCACATGATCAAAGACAACTCGAGTTGTCTTTGATCATGTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025347.1-338s1c1
Sequence:CCGGGCCTACCTCTTCAACTCTGTACTCGAGTACAGAGTTGAAGAGGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025347.1-456s1c1
Sequence:CCGGGCTGGAAATATGAGCAAGCCTCTCGAGAGGCTTGCTCATATTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025347.2-239s21c1
Sequence:CCGGATGACTGTCACCGGAGGTATACTCGAGTATACCTCCGGTGACAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025347.2-423s21c1
Sequence:CCGGCATCCACTGTGAGAACTGCAACTCGAGTTGCAGTTCTCACAGTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025347.2-337s21c1
Sequence:CCGGGCCTACCTCTTCAACTCTGTACTCGAGTACAGAGTTGAAGAGGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277324    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025347.2-663s21c1
Sequence:CCGGAGGACCCAGCTCCTGTACATACTCGAGTATGTACAGGAGCTGGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025347.2-522s21c1
Sequence:CCGGCAACCACATGATCAAAGACAACTCGAGTTGTCTTTGATCATGTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025347
VALIDATED
YPEL3 MISSION shRNA shRNA Plasmid DNA
yippee-like 3 (Drosophila)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200762    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025347.1-460s1c1
Sequence:CCGGGAAATATGAGCAAGCCTTTGACTCGAGTCAAAGGCTTGCTCATATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025347.1-424s1c1
Sequence:CCGGCATCCACTGTGAGAACTGCAACTCGAGTTGCAGTTCTCACAGTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025347.1-523s1c1
Sequence:CCGGCAACCACATGATCAAAGACAACTCGAGTTGTCTTTGATCATGTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025347.1-338s1c1
Sequence:CCGGGCCTACCTCTTCAACTCTGTACTCGAGTACAGAGTTGAAGAGGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025347.1-456s1c1
Sequence:CCGGGCTGGAAATATGAGCAAGCCTCTCGAGAGGCTTGCTCATATTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025347.2-239s21c1
Sequence:CCGGATGACTGTCACCGGAGGTATACTCGAGTATACCTCCGGTGACAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025347.2-423s21c1
Sequence:CCGGCATCCACTGTGAGAACTGCAACTCGAGTTGCAGTTCTCACAGTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025347.2-337s21c1
Sequence:CCGGGCCTACCTCTTCAACTCTGTACTCGAGTACAGAGTTGAAGAGGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277324    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025347.2-663s21c1
Sequence:CCGGAGGACCCAGCTCCTGTACATACTCGAGTATGTACAGGAGCTGGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025347.2-522s21c1
Sequence:CCGGCAACCACATGATCAAAGACAACTCGAGTTGTCTTTGATCATGTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025347
VALIDATED
YPEL3 MISSION shRNA Lentiviral Transduction Particles
yippee-like 3 (Drosophila)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200762    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025347.1-460s1c1
Sequence:CCGGGAAATATGAGCAAGCCTTTGACTCGAGTCAAAGGCTTGCTCATATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025347.1-424s1c1
Sequence:CCGGCATCCACTGTGAGAACTGCAACTCGAGTTGCAGTTCTCACAGTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025347.1-523s1c1
Sequence:CCGGCAACCACATGATCAAAGACAACTCGAGTTGTCTTTGATCATGTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025347.1-338s1c1
Sequence:CCGGGCCTACCTCTTCAACTCTGTACTCGAGTACAGAGTTGAAGAGGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025347.1-456s1c1
Sequence:CCGGGCTGGAAATATGAGCAAGCCTCTCGAGAGGCTTGCTCATATTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025347.2-239s21c1
Sequence:CCGGATGACTGTCACCGGAGGTATACTCGAGTATACCTCCGGTGACAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025347.2-423s21c1
Sequence:CCGGCATCCACTGTGAGAACTGCAACTCGAGTTGCAGTTCTCACAGTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025347.2-337s21c1
Sequence:CCGGGCCTACCTCTTCAACTCTGTACTCGAGTACAGAGTTGAAGAGGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277324    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025347.2-663s21c1
Sequence:CCGGAGGACCCAGCTCCTGTACATACTCGAGTATGTACAGGAGCTGGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025347.2-522s21c1
Sequence:CCGGCAACCACATGATCAAAGACAACTCGAGTTGTCTTTGATCATGTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks