EMAIL THIS PAGE TO A FRIEND

YPEL4

yippee-like 4 (Drosophila)

UniProtKB ID: Q96NS1, B3KW92, Q2M3U7, Q65Z98
Gene ID:
Mouse(241525) yippee-like 4 (Drosophila)
Rat(502643) yippee-like 4 (Drosophila)
naked mole-rat(101724315) yippee-like 4 (Drosophila)
domestic guinea pig(100721859) yippee-like 4 (Drosophila)
cow(613682) yippee-like 4 (Drosophila)
sheep(101121709) yippee-like 4 (Drosophila)
dog(610168) yippee-like 4 (Drosophila)
domestic cat(101090799) yippee-like 4 (Drosophila)
115 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301863 Anti-YPEL4 affinity isolated antibody mouse, human, rat
immunohistochemistry pricing
HPA045621 Anti-YPEL4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB3500657 Anti-YPEL4 antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunocytochemistry, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001005342 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001005342 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001005342 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_145008 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145008 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145008 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU056941 MISSION® esiRNA esiRNA targeting mouse Ypel4 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145008 Rosetta Predictions human pricing
NM_001024369 Rosetta Predictions rat pricing
NM_001005342 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145008 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069523 predicted 729
2 SASI_Hs01_00069524 predicted 556
3 SASI_Hs01_00069525 predicted 889
4 SASI_Hs01_00069527 predicted 558
5 SASI_Hs01_00069529 predicted 610
6 SASI_Hs01_00069530 predicted 712
7 SASI_Hs02_00364850 predicted 1073
8 SASI_Hs02_00364851 predicted 555
9 SASI_Hs02_00364852 predicted 1111
10 SASI_Hs02_00364853 predicted 1266
11 SASI_Hs01_00069522 predicted 490
12 SASI_Hs01_00069526 predicted 1191
13 SASI_Hs01_00069528 predicted 576
14 SASI_Hs01_00069531 predicted 1127
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024369 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115043 predicted 466
2 SASI_Rn01_00115044 predicted 624
3 SASI_Rn01_00115046 predicted 529
4 SASI_Rn01_00115047 predicted 1002
5 SASI_Rn02_00202601 predicted 1109
6 SASI_Rn01_00115048 predicted 396
7 SASI_Rn01_00115049 predicted 1037
8 SASI_Rn01_00115050 predicted 1165
9 SASI_Rn01_00115051 predicted 747
10 SASI_Rn01_00115052 predicted 1044
11 SASI_Rn01_00115045 predicted 470
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005342 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00161082 predicted 429
2 SASI_Mm01_00161083 predicted 499
3 SASI_Mm01_00161084 predicted 434
4 SASI_Mm01_00161085 predicted 434
5 SASI_Mm01_00161086 predicted 447
6 SASI_Mm02_00286572 predicted 503
7 SASI_Mm01_00161087 predicted 380
8 SASI_Mm01_00161088 predicted 505
9 SASI_Mm01_00161089 predicted 429
10 SASI_Mm01_00161091 predicted 466
11 SASI_Mm01_00161090 predicted 496
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005342
YPEL4 MISSION shRNA Bacterial Glycerol Stock
yippee-like 4 (Drosophila)
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005342.2-583s1c1
Sequence:CCGGGAGACCAGCCAGAAATACAAACTCGAGTTTGTATTTCTGGCTGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005342.2-590s1c1
Sequence:CCGGGCCAGAAATACAAAGAAGGGACTCGAGTCCCTTCTTTGTATTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005342.2-600s1c1
Sequence:CCGGCAAAGAAGGGAAGTACATCATCTCGAGATGATGTACTTCCCTTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005342.2-406s1c1
Sequence:CCGGCTTATTTCCAAGTCCTTCCAACTCGAGTTGGAAGGACTTGGAAATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174612    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005342.2-594s1c1
Sequence:CCGGGAAATACAAAGAAGGGAAGTACTCGAGTACTTCCCTTCTTTGTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005342.2-308s1c1
Sequence:CCGGCATGTTTACCCACCAAGACTTCTCGAGAAGTCTTGGTGGGTAAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005342
YPEL4 MISSION shRNA shRNA Plasmid DNA
yippee-like 4 (Drosophila)
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005342.2-583s1c1
Sequence:CCGGGAGACCAGCCAGAAATACAAACTCGAGTTTGTATTTCTGGCTGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005342.2-590s1c1
Sequence:CCGGGCCAGAAATACAAAGAAGGGACTCGAGTCCCTTCTTTGTATTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005342.2-600s1c1
Sequence:CCGGCAAAGAAGGGAAGTACATCATCTCGAGATGATGTACTTCCCTTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005342.2-406s1c1
Sequence:CCGGCTTATTTCCAAGTCCTTCCAACTCGAGTTGGAAGGACTTGGAAATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174612    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005342.2-594s1c1
Sequence:CCGGGAAATACAAAGAAGGGAAGTACTCGAGTACTTCCCTTCTTTGTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005342.2-308s1c1
Sequence:CCGGCATGTTTACCCACCAAGACTTCTCGAGAAGTCTTGGTGGGTAAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005342
YPEL4 MISSION shRNA Lentiviral Transduction Particles
yippee-like 4 (Drosophila)
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005342.2-583s1c1
Sequence:CCGGGAGACCAGCCAGAAATACAAACTCGAGTTTGTATTTCTGGCTGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005342.2-590s1c1
Sequence:CCGGGCCAGAAATACAAAGAAGGGACTCGAGTCCCTTCTTTGTATTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005342.2-600s1c1
Sequence:CCGGCAAAGAAGGGAAGTACATCATCTCGAGATGATGTACTTCCCTTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005342.2-406s1c1
Sequence:CCGGCTTATTTCCAAGTCCTTCCAACTCGAGTTGGAAGGACTTGGAAATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174612    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005342.2-594s1c1
Sequence:CCGGGAAATACAAAGAAGGGAAGTACTCGAGTACTTCCCTTCTTTGTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005342.2-308s1c1
Sequence:CCGGCATGTTTACCCACCAAGACTTCTCGAGAAGTCTTGGTGGGTAAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145008
YPEL4 MISSION shRNA Bacterial Glycerol Stock
yippee-like 4 (Drosophila)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138562    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145008.1-1232s1c1
Sequence:CCGGCCACAGAACAGCAGATGAGAACTCGAGTTCTCATCTGCTGTTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145008.1-615s1c1
Sequence:CCGGCCTGTTTAACTCCGTGGTCAACTCGAGTTGACCACGGAGTTAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134295    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145008.1-762s1c1
Sequence:CCGGGAAGTACAAGGAAGGGAAATACTCGAGTATTTCCCTTCCTTGTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145008.1-786s1c1
Sequence:CCGGCATTGAAATGTCACACATGGTCTCGAGACCATGTGTGACATTTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135494    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145008.1-728s1c1
Sequence:CCGGGCTGGAAATATGAGCAAGCTTCTCGAGAAGCTTGCTCATATTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145008.1-759s1c1
Sequence:CCGGCCAGAAGTACAAGGAAGGGAACTCGAGTTCCCTTCCTTGTACTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145008.1-489s1c1
Sequence:CCGGCAAGACTTTCCGCAGCTATCTCTCGAGAGATAGCTGCGGAAAGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138010    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145008.1-618s1c1
Sequence:CCGGGTTTAACTCCGTGGTCAACGTCTCGAGACGTTGACCACGGAGTTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145008
YPEL4 MISSION shRNA shRNA Plasmid DNA
yippee-like 4 (Drosophila)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138562    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145008.1-1232s1c1
Sequence:CCGGCCACAGAACAGCAGATGAGAACTCGAGTTCTCATCTGCTGTTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145008.1-615s1c1
Sequence:CCGGCCTGTTTAACTCCGTGGTCAACTCGAGTTGACCACGGAGTTAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134295    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145008.1-762s1c1
Sequence:CCGGGAAGTACAAGGAAGGGAAATACTCGAGTATTTCCCTTCCTTGTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145008.1-786s1c1
Sequence:CCGGCATTGAAATGTCACACATGGTCTCGAGACCATGTGTGACATTTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135494    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145008.1-728s1c1
Sequence:CCGGGCTGGAAATATGAGCAAGCTTCTCGAGAAGCTTGCTCATATTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145008.1-759s1c1
Sequence:CCGGCCAGAAGTACAAGGAAGGGAACTCGAGTTCCCTTCCTTGTACTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145008.1-489s1c1
Sequence:CCGGCAAGACTTTCCGCAGCTATCTCTCGAGAGATAGCTGCGGAAAGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138010    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145008.1-618s1c1
Sequence:CCGGGTTTAACTCCGTGGTCAACGTCTCGAGACGTTGACCACGGAGTTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145008
YPEL4 MISSION shRNA Lentiviral Transduction Particles
yippee-like 4 (Drosophila)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138562    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145008.1-1232s1c1
Sequence:CCGGCCACAGAACAGCAGATGAGAACTCGAGTTCTCATCTGCTGTTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145008.1-615s1c1
Sequence:CCGGCCTGTTTAACTCCGTGGTCAACTCGAGTTGACCACGGAGTTAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134295    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145008.1-762s1c1
Sequence:CCGGGAAGTACAAGGAAGGGAAATACTCGAGTATTTCCCTTCCTTGTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145008.1-786s1c1
Sequence:CCGGCATTGAAATGTCACACATGGTCTCGAGACCATGTGTGACATTTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135494    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145008.1-728s1c1
Sequence:CCGGGCTGGAAATATGAGCAAGCTTCTCGAGAAGCTTGCTCATATTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145008.1-759s1c1
Sequence:CCGGCCAGAAGTACAAGGAAGGGAACTCGAGTTCCCTTCCTTGTACTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145008.1-489s1c1
Sequence:CCGGCAAGACTTTCCGCAGCTATCTCTCGAGAGATAGCTGCGGAAAGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138010    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145008.1-618s1c1
Sequence:CCGGGTTTAACTCCGTGGTCAACGTCTCGAGACGTTGACCACGGAGTTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks