EMAIL THIS PAGE TO A FRIEND

YPEL5

yippee-like 5 (Drosophila)

Gene ID:
Mouse(383295) yippee-like 5 (Drosophila)
Rat(298792) yippee-like 5 (Drosophila)
Zebrafish(393449) yippee-like 5
chicken(421299) yippee-like 5 (Drosophila)
domestic cat(101090685) yippee-like 5 (Drosophila)
dog(475714) yippee-like 5 (Drosophila)
cow(780856) yippee-like 5 (Drosophila)
sheep(101103386) yippee-like 5 (Drosophila)
domestic guinea pig(100729553) yippee-like 5 (Drosophila)
naked mole-rat(101703666) yippee-like 5 (Drosophila)
198 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016061 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016061 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016061 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027166 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027166 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027166 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU130581 MISSION® esiRNA esiRNA human YPEL5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127399 Rosetta Predictions human pricing
NM_001127400 Rosetta Predictions human pricing
NM_001127401 Rosetta Predictions human pricing
NM_016061 Rosetta Predictions human pricing
NM_001035221 Rosetta Predictions rat pricing
NM_027166 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127399 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329464 predicted 517
2 SASI_Hs02_00329465 predicted 508
3 SASI_Hs02_00329466 predicted 695
4 SASI_Hs02_00329467 predicted 593
5 SASI_Hs02_00329468 predicted 726
6 SASI_Hs02_00329469 predicted 818
7 SASI_Hs02_00329470 predicted 893
8 SASI_Hs02_00329471 predicted 1088
9 SASI_Hs02_00329472 predicted 715
10 SASI_Hs02_00329473 predicted 1072
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127400 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329474 predicted 753
2 SASI_Hs02_00329475 predicted 748
3 SASI_Hs02_00329476 predicted 933
4 SASI_Hs02_00329477 predicted 825
5 SASI_Hs02_00329478 predicted 963
6 SASI_Hs02_00329479 predicted 1059
7 SASI_Hs02_00329480 predicted 1127
8 SASI_Hs02_00329481 predicted 1326
9 SASI_Hs02_00329482 predicted 952
10 SASI_Hs02_00329483 predicted 1309
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127401 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329484 predicted 822
2 SASI_Hs02_00329485 predicted 806
3 SASI_Hs02_00329486 predicted 1000
4 SASI_Hs02_00329487 predicted 887
5 SASI_Hs02_00329488 predicted 1027
6 SASI_Hs02_00329489 predicted 1123
7 SASI_Hs02_00329490 predicted 1192
8 SASI_Hs02_00329491 predicted 1381
9 SASI_Hs02_00329492 predicted 1012
10 SASI_Hs02_00329493 predicted 1369
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016061 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211861 predicted 457
2 SASI_Hs01_00211862 predicted 446
3 SASI_Hs01_00211863 predicted 635
4 SASI_Hs02_00348793 predicted 532
5 SASI_Hs01_00211864 predicted 673
6 SASI_Hs02_00348794 predicted 759
7 SASI_Hs01_00211866 predicted 830
8 SASI_Hs01_00211867 predicted 1028
9 SASI_Hs01_00211868 predicted 656
10 SASI_Hs01_00211869 predicted 1017
11 SASI_Hs01_00211865 predicted 206
12 SASI_Hs01_00211870 predicted 675
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001035221 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035461 predicted 877
2 SASI_Rn01_00035462 predicted 368
3 SASI_Rn01_00035463 predicted 901
4 SASI_Rn01_00035465 predicted 436
5 SASI_Rn01_00035466 predicted 115
6 SASI_Rn01_00035467 predicted 715
7 SASI_Rn01_00035468 predicted 357
8 SASI_Rn01_00035469 predicted 548
9 SASI_Rn01_00035470 predicted 191
10 SASI_Rn01_00035464 predicted 246
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027166 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00066328 predicted 115
2 SASI_Mm01_00066329 predicted 112
3 SASI_Mm01_00066332 predicted 187
4 SASI_Mm01_00066334 predicted 131
5 SASI_Mm02_00331684 predicted 367
6 SASI_Mm01_00066330 predicted 549
7 SASI_Mm01_00066331 predicted 736
8 SASI_Mm01_00066333 predicted 247
9 SASI_Mm02_00331685 predicted 458
10 SASI_Mm01_00066336 predicted 385
11 SASI_Mm01_00066327 predicted 716
12 SASI_Mm01_00066335 predicted 533
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016061
VALIDATED
YPEL5 MISSION shRNA Bacterial Glycerol Stock
yippee-like 5 (Drosophila)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130158    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_016061.1-1076s1c1
Sequence:CCGGCCTAGTTATTTGTCACCACATCTCGAGATGTGGTGACAAATAACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016061.1-178s1c1
Sequence:CCGGCAAACTGTGATACGATCCTGACTCGAGTCAGGATCGTATCACAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150155    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016061.1-1869s1c1
Sequence:CCGGGCCTCAGTTGAATTAGTGAAACTCGAGTTTCACTAATTCAACTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_016061.1-363s1c1
Sequence:CCGGCTGGGATGGATCTATGAGTTTCTCGAGAAACTCATAGATCCATCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146412    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016061.1-172s1c1
Sequence:CCGGCTTGTGCAAACTGTGATACGACTCGAGTCGTATCACAGTTTGCACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_016061.2-405s21c1
Sequence:CCGGGTTCGAGATGTGAGCTGCAAACTCGAGTTTGCAGCTCACATCTCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_016061.2-288s21c1
Sequence:CCGGGAACTCATCTCCACTCGTTTCCTCGAGGAAACGAGTGGAGATGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_016061.2-542s21c1
Sequence:CCGGGGAGCATGTACCATCTGATAACTCGAGTTATCAGATGGTACATGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276518    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_016061.2-1154s21c1
Sequence:CCGGCCTAGTTATTTGTCACCACATCTCGAGATGTGGTGACAAATAACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016061.2-498s21c1
Sequence:CCGGGTGATCCTGGAACGTGCTCTACTCGAGTAGAGCACGTTCCAGGATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016061
VALIDATED
YPEL5 MISSION shRNA shRNA Plasmid DNA
yippee-like 5 (Drosophila)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130158    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_016061.1-1076s1c1
Sequence:CCGGCCTAGTTATTTGTCACCACATCTCGAGATGTGGTGACAAATAACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016061.1-178s1c1
Sequence:CCGGCAAACTGTGATACGATCCTGACTCGAGTCAGGATCGTATCACAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150155    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016061.1-1869s1c1
Sequence:CCGGGCCTCAGTTGAATTAGTGAAACTCGAGTTTCACTAATTCAACTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_016061.1-363s1c1
Sequence:CCGGCTGGGATGGATCTATGAGTTTCTCGAGAAACTCATAGATCCATCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146412    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016061.1-172s1c1
Sequence:CCGGCTTGTGCAAACTGTGATACGACTCGAGTCGTATCACAGTTTGCACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_016061.2-405s21c1
Sequence:CCGGGTTCGAGATGTGAGCTGCAAACTCGAGTTTGCAGCTCACATCTCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_016061.2-288s21c1
Sequence:CCGGGAACTCATCTCCACTCGTTTCCTCGAGGAAACGAGTGGAGATGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_016061.2-542s21c1
Sequence:CCGGGGAGCATGTACCATCTGATAACTCGAGTTATCAGATGGTACATGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276518    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_016061.2-1154s21c1
Sequence:CCGGCCTAGTTATTTGTCACCACATCTCGAGATGTGGTGACAAATAACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016061.2-498s21c1
Sequence:CCGGGTGATCCTGGAACGTGCTCTACTCGAGTAGAGCACGTTCCAGGATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016061
VALIDATED
YPEL5 MISSION shRNA Lentiviral Transduction Particles
yippee-like 5 (Drosophila)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130158    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_016061.1-1076s1c1
Sequence:CCGGCCTAGTTATTTGTCACCACATCTCGAGATGTGGTGACAAATAACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016061.1-178s1c1
Sequence:CCGGCAAACTGTGATACGATCCTGACTCGAGTCAGGATCGTATCACAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150155    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016061.1-1869s1c1
Sequence:CCGGGCCTCAGTTGAATTAGTGAAACTCGAGTTTCACTAATTCAACTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_016061.1-363s1c1
Sequence:CCGGCTGGGATGGATCTATGAGTTTCTCGAGAAACTCATAGATCCATCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146412    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016061.1-172s1c1
Sequence:CCGGCTTGTGCAAACTGTGATACGACTCGAGTCGTATCACAGTTTGCACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_016061.2-405s21c1
Sequence:CCGGGTTCGAGATGTGAGCTGCAAACTCGAGTTTGCAGCTCACATCTCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_016061.2-288s21c1
Sequence:CCGGGAACTCATCTCCACTCGTTTCCTCGAGGAAACGAGTGGAGATGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_016061.2-542s21c1
Sequence:CCGGGGAGCATGTACCATCTGATAACTCGAGTTATCAGATGGTACATGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276518    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_016061.2-1154s21c1
Sequence:CCGGCCTAGTTATTTGTCACCACATCTCGAGATGTGGTGACAAATAACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016061.2-498s21c1
Sequence:CCGGGTGATCCTGGAACGTGCTCTACTCGAGTAGAGCACGTTCCAGGATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027166
VALIDATED
YPEL5 MISSION shRNA Bacterial Glycerol Stock
yippee-like 5 (Drosophila)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000179685    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027166.3-2450s1c1
Sequence:CCGGGCCAGATACAACTGTGGTTTACTCGAGTAAACCACAGTTGTATCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178815    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027166.3-170s1c1
Sequence:CCGGCTGTGATACAATCCTGACCAACTCGAGTTGGTCAGGATTGTATCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196016    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027166.3-315s1c1
Sequence:CCGGGTTCGAGATGTGAGCTGCAAACTCGAGTTTGCAGCTCACATCTCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_027166.5-376s21c1
Sequence:CCGGTGAAGACAGCCAGCGTTATAACTCGAGTTATAACGCTGGCTGTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_027166.5-161s21c1
Sequence:CCGGTGTGCAAACTGTGATACAATCCTCGAGGATTGTATCACAGTTTGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027166.5-451s21c1
Sequence:CCGGAGAGCATGTACCATCTGATAACTCGAGTTATCAGATGGTACATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027166.5-345s21c1
Sequence:CCGGGCAAACTGGGATGGATCTATGCTCGAGCATAGATCCATCCCAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251404    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027166.5-1914s21c1
Sequence:CCGGCTTGAGCAGAGATAGTATAATCTCGAGATTATACTATCTCTGCTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027166
VALIDATED
YPEL5 MISSION shRNA shRNA Plasmid DNA
yippee-like 5 (Drosophila)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000179685    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027166.3-2450s1c1
Sequence:CCGGGCCAGATACAACTGTGGTTTACTCGAGTAAACCACAGTTGTATCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178815    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027166.3-170s1c1
Sequence:CCGGCTGTGATACAATCCTGACCAACTCGAGTTGGTCAGGATTGTATCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196016    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027166.3-315s1c1
Sequence:CCGGGTTCGAGATGTGAGCTGCAAACTCGAGTTTGCAGCTCACATCTCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_027166.5-376s21c1
Sequence:CCGGTGAAGACAGCCAGCGTTATAACTCGAGTTATAACGCTGGCTGTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_027166.5-161s21c1
Sequence:CCGGTGTGCAAACTGTGATACAATCCTCGAGGATTGTATCACAGTTTGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027166.5-451s21c1
Sequence:CCGGAGAGCATGTACCATCTGATAACTCGAGTTATCAGATGGTACATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027166.5-345s21c1
Sequence:CCGGGCAAACTGGGATGGATCTATGCTCGAGCATAGATCCATCCCAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251404    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027166.5-1914s21c1
Sequence:CCGGCTTGAGCAGAGATAGTATAATCTCGAGATTATACTATCTCTGCTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027166
VALIDATED
YPEL5 MISSION shRNA Lentiviral Transduction Particles
yippee-like 5 (Drosophila)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000179685    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027166.3-2450s1c1
Sequence:CCGGGCCAGATACAACTGTGGTTTACTCGAGTAAACCACAGTTGTATCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178815    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027166.3-170s1c1
Sequence:CCGGCTGTGATACAATCCTGACCAACTCGAGTTGGTCAGGATTGTATCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196016    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027166.3-315s1c1
Sequence:CCGGGTTCGAGATGTGAGCTGCAAACTCGAGTTTGCAGCTCACATCTCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_027166.5-376s21c1
Sequence:CCGGTGAAGACAGCCAGCGTTATAACTCGAGTTATAACGCTGGCTGTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_027166.5-161s21c1
Sequence:CCGGTGTGCAAACTGTGATACAATCCTCGAGGATTGTATCACAGTTTGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027166.5-451s21c1
Sequence:CCGGAGAGCATGTACCATCTGATAACTCGAGTTATCAGATGGTACATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027166.5-345s21c1
Sequence:CCGGGCAAACTGGGATGGATCTATGCTCGAGCATAGATCCATCCCAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251404    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027166.5-1914s21c1
Sequence:CCGGCTTGAGCAGAGATAGTATAATCTCGAGATTATACTATCTCTGCTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks