EMAIL THIS PAGE TO A FRIEND

YRDC

yrdC N(6)-threonylcarbamoyltransferase domain containing

Synonyms: DRIP3 IRIP RP11-109P14.4 SUA5
UniProtKB ID: Q86U90, Q4W4X8, Q6NVW3, Q7L4E4, Q7Z2I4, Q9H5F8
Gene ID:
Mouse(230734) yrdC domain containing (E.coli)
Rat(319113) yrdC domain containing (E.coli)
chicken(419610) yrdC domain containing (E. coli)
dog(482469) yrdC domain containing (E. coli)
domestic cat(101088863) yrdC domain containing (E. coli)
naked mole-rat(101703606) yrdC domain containing (E. coli)
domestic guinea pig(100713984) yrdC domain containing (E. coli)
cow(512062) yrdC domain containing (E. coli)
sheep(101119101) yrdC domain containing (E. coli)
71 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301743 Anti-YRDC affinity isolated antibody mouse, human
immunohistochemistry, western blot pricing
HPA030147 Anti-YRDC antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024640 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024640 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024640 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153566 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153566 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153566 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024640 Rosetta Predictions human pricing
NM_175604 Rosetta Predictions rat pricing
NM_153566 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024640 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00210563 predicted 527
2 SASI_Hs01_00210564 predicted 615
3 SASI_Hs01_00210565 predicted 866
4 SASI_Hs01_00210566 predicted 936
5 SASI_Hs01_00210567 predicted 522
6 SASI_Hs01_00210568 predicted 505
7 SASI_Hs02_00357023 predicted 586
8 SASI_Hs01_00210570 predicted 889
9 SASI_Hs01_00210571 predicted 650
10 SASI_Hs02_00357024 predicted 622
11 SASI_Hs01_00210569 predicted 714
12 SASI_Hs01_00210572 predicted 978
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175604 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00058458 predicted 971
2 SASI_Rn01_00058459 predicted 1032
3 SASI_Rn01_00058460 predicted 628
4 SASI_Rn01_00058461 predicted 913
5 SASI_Rn01_00058462 predicted 1158
6 SASI_Rn01_00058463 predicted 1154
7 SASI_Rn01_00058464 predicted 1188
8 SASI_Rn02_00269502 predicted 1276
9 SASI_Rn01_00058466 predicted 1165
10 SASI_Rn01_00058467 predicted 759
11 SASI_Rn01_00058465 predicted 1242
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153566 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00192638 predicted 1074
2 SASI_Mm01_00192640 predicted 445
3 SASI_Mm01_00192641 predicted 1068
4 SASI_Mm01_00192642 predicted 741
5 SASI_Mm01_00192643 predicted 853
6 SASI_Mm01_00192644 predicted 1273
7 SASI_Mm01_00192645 predicted 1222
8 SASI_Mm01_00192646 predicted 712
9 SASI_Mm01_00192647 predicted 900
10 SASI_Mm02_00343362 predicted 501
11 SASI_Mm01_00192639 predicted 875
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024640
VALIDATED
YRDC MISSION shRNA Bacterial Glycerol Stock
yrdC N(6)-threonylcarbamoyltransferase domain containing
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024640.3-554s21c1
Sequence:CCGGCAAGACTTGGCTCAGATGTTTCTCGAGAAACATCTGAGCCAAGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024640.3-397s21c1
Sequence:CCGGCTACAGATACTGCCGTGTGAGCTCGAGCTCACACGGCAGTATCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024640.3-619s21c1
Sequence:CCGGCAGTTCTCTGAATGTCGAGGACTCGAGTCCTCGACATTCAGAGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024640.3-741s21c1
Sequence:CCGGTGTCTGTGCCCGGAAAGTTTGCTCGAGCAAACTTTCCGGGCACAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024640.3-657s21c1
Sequence:CCGGCTCAGTTGTCCTTGGTTATTGCTCGAGCAATAACCAAGGACAACTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343555    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024640.3-913s21c1
Sequence:CCGGACGACTGTCAAGGCCTCATTTCTCGAGAAATGAGGCCTTGACAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370068    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024640.3-879s21c1
Sequence:CCGGGACCTGGTGCTGGATACTATGCTCGAGCATAGTATCCAGCACCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167989    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024640.3-656s1c1
Sequence:CCGGCCTCAGTTGTCCTTGGTTATTCTCGAGAATAACCAAGGACAACTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024640.3-619s1c1
Sequence:CCGGCAGTTCTCTGAATGTCGAGGACTCGAGTCCTCGACATTCAGAGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134680    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_024640.3-1441s1c1
Sequence:CCGGGAACCAGGTTTGGATAAAGATCTCGAGATCTTTATCCAAACCTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024640.3-784s1c1
Sequence:CCGGCCTGGAAAGTACTACAGCCATCTCGAGATGGCTGTAGTACTTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024640.3-490s1c1
Sequence:CCGGCAACAAGGACCTAAACCCTTTCTCGAGAAAGGGTTTAGGTCCTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024640
VALIDATED
YRDC MISSION shRNA shRNA Plasmid DNA
yrdC N(6)-threonylcarbamoyltransferase domain containing
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024640.3-554s21c1
Sequence:CCGGCAAGACTTGGCTCAGATGTTTCTCGAGAAACATCTGAGCCAAGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024640.3-397s21c1
Sequence:CCGGCTACAGATACTGCCGTGTGAGCTCGAGCTCACACGGCAGTATCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024640.3-619s21c1
Sequence:CCGGCAGTTCTCTGAATGTCGAGGACTCGAGTCCTCGACATTCAGAGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024640.3-741s21c1
Sequence:CCGGTGTCTGTGCCCGGAAAGTTTGCTCGAGCAAACTTTCCGGGCACAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024640.3-657s21c1
Sequence:CCGGCTCAGTTGTCCTTGGTTATTGCTCGAGCAATAACCAAGGACAACTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343555    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024640.3-913s21c1
Sequence:CCGGACGACTGTCAAGGCCTCATTTCTCGAGAAATGAGGCCTTGACAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370068    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024640.3-879s21c1
Sequence:CCGGGACCTGGTGCTGGATACTATGCTCGAGCATAGTATCCAGCACCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167989    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024640.3-656s1c1
Sequence:CCGGCCTCAGTTGTCCTTGGTTATTCTCGAGAATAACCAAGGACAACTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024640.3-619s1c1
Sequence:CCGGCAGTTCTCTGAATGTCGAGGACTCGAGTCCTCGACATTCAGAGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134680    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_024640.3-1441s1c1
Sequence:CCGGGAACCAGGTTTGGATAAAGATCTCGAGATCTTTATCCAAACCTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024640.3-784s1c1
Sequence:CCGGCCTGGAAAGTACTACAGCCATCTCGAGATGGCTGTAGTACTTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024640.3-490s1c1
Sequence:CCGGCAACAAGGACCTAAACCCTTTCTCGAGAAAGGGTTTAGGTCCTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024640
VALIDATED
YRDC MISSION shRNA Lentiviral Transduction Particles
yrdC N(6)-threonylcarbamoyltransferase domain containing
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024640.3-554s21c1
Sequence:CCGGCAAGACTTGGCTCAGATGTTTCTCGAGAAACATCTGAGCCAAGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024640.3-397s21c1
Sequence:CCGGCTACAGATACTGCCGTGTGAGCTCGAGCTCACACGGCAGTATCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024640.3-619s21c1
Sequence:CCGGCAGTTCTCTGAATGTCGAGGACTCGAGTCCTCGACATTCAGAGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024640.3-741s21c1
Sequence:CCGGTGTCTGTGCCCGGAAAGTTTGCTCGAGCAAACTTTCCGGGCACAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024640.3-657s21c1
Sequence:CCGGCTCAGTTGTCCTTGGTTATTGCTCGAGCAATAACCAAGGACAACTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343555    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024640.3-913s21c1
Sequence:CCGGACGACTGTCAAGGCCTCATTTCTCGAGAAATGAGGCCTTGACAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370068    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024640.3-879s21c1
Sequence:CCGGGACCTGGTGCTGGATACTATGCTCGAGCATAGTATCCAGCACCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167989    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024640.3-656s1c1
Sequence:CCGGCCTCAGTTGTCCTTGGTTATTCTCGAGAATAACCAAGGACAACTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024640.3-619s1c1
Sequence:CCGGCAGTTCTCTGAATGTCGAGGACTCGAGTCCTCGACATTCAGAGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134680    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_024640.3-1441s1c1
Sequence:CCGGGAACCAGGTTTGGATAAAGATCTCGAGATCTTTATCCAAACCTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024640.3-784s1c1
Sequence:CCGGCCTGGAAAGTACTACAGCCATCTCGAGATGGCTGTAGTACTTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024640.3-490s1c1
Sequence:CCGGCAACAAGGACCTAAACCCTTTCTCGAGAAAGGGTTTAGGTCCTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153566
VALIDATED
YRDC MISSION shRNA Bacterial Glycerol Stock
yrdC N(6)-threonylcarbamoyltransferase domain containing
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241816    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153566.1-1079s21c1
Sequence:CCGGTTCTTAGAGTGGCCTTATTATCTCGAGATAATAAGGCCACTCTAAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153566.1-742s21c1
Sequence:CCGGCTGGAAAGTTTGGCATTATTCCTCGAGGAATAATGCCAAACTTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153566.1-636s21c1
Sequence:CCGGCAAGACCTCTGGCCTCATTTGCTCGAGCAAATGAGGCCAGAGGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153566.1-315s21c1
Sequence:CCGGAGTTGCGTGTACCGCCTCAAACTCGAGTTTGAGGCGGTACACGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153566.1-716s21c1
Sequence:CCGGCTCTACTGTGGTTGACTTATCCTCGAGGATAAGTCAACCACAGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184576    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153566.1-647s1c1
Sequence:CCGGGCCTCATTTGTCCCTTGTCATCTCGAGATGACAAGGGACAAATGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183843    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153566.1-741s1c1
Sequence:CCGGCCTGGAAAGTTTGGCATTATTCTCGAGAATAATGCCAAACTTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180117    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153566.1-648s1c1
Sequence:CCGGCCTCATTTGTCCCTTGTCATTCTCGAGAATGACAAGGGACAAATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153566
VALIDATED
YRDC MISSION shRNA shRNA Plasmid DNA
yrdC N(6)-threonylcarbamoyltransferase domain containing
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241816    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153566.1-1079s21c1
Sequence:CCGGTTCTTAGAGTGGCCTTATTATCTCGAGATAATAAGGCCACTCTAAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153566.1-742s21c1
Sequence:CCGGCTGGAAAGTTTGGCATTATTCCTCGAGGAATAATGCCAAACTTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153566.1-636s21c1
Sequence:CCGGCAAGACCTCTGGCCTCATTTGCTCGAGCAAATGAGGCCAGAGGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153566.1-315s21c1
Sequence:CCGGAGTTGCGTGTACCGCCTCAAACTCGAGTTTGAGGCGGTACACGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153566.1-716s21c1
Sequence:CCGGCTCTACTGTGGTTGACTTATCCTCGAGGATAAGTCAACCACAGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184576    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153566.1-647s1c1
Sequence:CCGGGCCTCATTTGTCCCTTGTCATCTCGAGATGACAAGGGACAAATGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183843    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153566.1-741s1c1
Sequence:CCGGCCTGGAAAGTTTGGCATTATTCTCGAGAATAATGCCAAACTTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180117    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153566.1-648s1c1
Sequence:CCGGCCTCATTTGTCCCTTGTCATTCTCGAGAATGACAAGGGACAAATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153566
VALIDATED
YRDC MISSION shRNA Lentiviral Transduction Particles
yrdC N(6)-threonylcarbamoyltransferase domain containing
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241816    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153566.1-1079s21c1
Sequence:CCGGTTCTTAGAGTGGCCTTATTATCTCGAGATAATAAGGCCACTCTAAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153566.1-742s21c1
Sequence:CCGGCTGGAAAGTTTGGCATTATTCCTCGAGGAATAATGCCAAACTTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153566.1-636s21c1
Sequence:CCGGCAAGACCTCTGGCCTCATTTGCTCGAGCAAATGAGGCCAGAGGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153566.1-315s21c1
Sequence:CCGGAGTTGCGTGTACCGCCTCAAACTCGAGTTTGAGGCGGTACACGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153566.1-716s21c1
Sequence:CCGGCTCTACTGTGGTTGACTTATCCTCGAGGATAAGTCAACCACAGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184576    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153566.1-647s1c1
Sequence:CCGGGCCTCATTTGTCCCTTGTCATCTCGAGATGACAAGGGACAAATGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183843    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153566.1-741s1c1
Sequence:CCGGCCTGGAAAGTTTGGCATTATTCTCGAGAATAATGCCAAACTTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180117    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153566.1-648s1c1
Sequence:CCGGCCTCATTTGTCCCTTGTCATTCTCGAGAATGACAAGGGACAAATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks