EMAIL THIS PAGE TO A FRIEND

YTHDC1

YTH domain containing 1

Synonyms: YT521 YT521-B
UniProtKB ID: Q96MU7, Q4W5Q3, Q7Z622, Q8TF35
Gene ID:
Mouse(231386) YTH domain containing 1
Rat(170956) YTH domain containing 1
Zebrafish(492769) YTH domain containing 1
dog(475161) YTH domain containing 1
domestic cat(101087921) YTH domain containing 1
Horse(100066303) YTH domain containing 1
chicken(422656) YTH domain containing 1
cow(613858) YTH domain containing 1
sheep(101116479) YTH domain containing 1
naked mole-rat(101701368) YTH domain containing 1
domestic guinea pig(100722788) YTH domain containing 1
125 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA036462 Anti-YTHDC1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133370 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_133370 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_133370 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177680 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177680 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177680 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031732 Rosetta Predictions human pricing
NM_133370 Rosetta Predictions human pricing
NM_133423 Rosetta Predictions rat pricing
NM_177680 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031732 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062766 predicted 1848
2 SASI_Hs02_00307782 predicted 1769
3 SASI_Hs01_00062768 predicted 1701
4 SASI_Hs02_00307783 predicted 1632
5 SASI_Hs01_00062769 predicted 1699
6 SASI_Hs02_00307784 predicted 1744
7 SASI_Hs01_00062771 predicted 2021
8 SASI_Hs01_00062772 predicted 1729
9 SASI_Hs01_00062773 predicted 1869
10 SASI_Hs01_00062774 predicted 1866
11 SASI_Hs01_00062765 predicted 2122
12 SASI_Hs01_00062767 predicted 2083
13 SASI_Hs01_00062770 predicted 2088
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133370 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115890 predicted 1790
2 SASI_Hs02_00363062 predicted 1718
3 SASI_Hs01_00115892 predicted 1639
4 SASI_Hs02_00363063 predicted 1582
5 SASI_Hs01_00115893 predicted 1644
6 SASI_Hs02_00363064 predicted 1685
7 SASI_Hs01_00115895 predicted 1971
8 SASI_Hs01_00115896 predicted 1682
9 SASI_Hs01_00115897 predicted 1819
10 SASI_Hs01_00115898 predicted 1816
11 SASI_Hs01_00115889 predicted 2063
12 SASI_Hs01_00115891 predicted 2036
13 SASI_Hs01_00115894 predicted 2029
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133423 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00106447 predicted 1797
2 SASI_Rn01_00106448 predicted 1356
3 SASI_Rn01_00106449 predicted 1483
4 SASI_Rn01_00106450 predicted 1504
5 SASI_Rn01_00106452 predicted 1030
6 SASI_Rn01_00106453 predicted 1186
7 SASI_Rn01_00106454 predicted 339
8 SASI_Rn01_00106455 predicted 1547
9 SASI_Rn01_00106456 predicted 1263
10 SASI_Rn02_00267681 predicted 999
11 SASI_Rn01_00106451 predicted 1178
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177680 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00348000 predicted 1865
2 SASI_Mm02_00348001 predicted 1554
3 SASI_Mm02_00348002 predicted 1566
4 SASI_Mm02_00348003 predicted 1017
5 SASI_Mm02_00348004 predicted 1425
6 SASI_Mm02_00348005 predicted 1094
7 SASI_Mm02_00348006 predicted 417
8 SASI_Mm02_00348007 predicted 1465
9 SASI_Mm02_00348008 predicted 1526
10 SASI_Mm02_00348009 predicted 1717
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133370
VALIDATED
YTHDC1 MISSION shRNA Bacterial Glycerol Stock
YTH domain containing 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000147357    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133370.1-2622s1c1
Sequence:CCGGGCAGTATCATAAGAACTGGAACTCGAGTTCCAGTTCTTATGATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257171    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133370.2-3510s21c1
Sequence:CCGGCTGATCACAGAATCGTTTATTCTCGAGAATAAACGATTCTGTGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133370.2-1971s21c1
Sequence:CCGGCACCAGAGACCAGGGTATTTACTCGAGTAAATACCCTGGTCTCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133370.2-2393s21c1
Sequence:CCGGGCGAGATAGAGGACGTGATAGCTCGAGCTATCACGTCCTCTATCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_133370.2-713s21c1
Sequence:CCGGTGCCTCCAGAGAACCTTATAACTCGAGTTATAAGGTTCTCTGGAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_133370.2-1638s21c1
Sequence:CCGGTGGATTTGCAGGCGTGAATTACTCGAGTAATTCACGCCTGCAAATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133370
VALIDATED
YTHDC1 MISSION shRNA shRNA Plasmid DNA
YTH domain containing 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000147357    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133370.1-2622s1c1
Sequence:CCGGGCAGTATCATAAGAACTGGAACTCGAGTTCCAGTTCTTATGATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257171    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133370.2-3510s21c1
Sequence:CCGGCTGATCACAGAATCGTTTATTCTCGAGAATAAACGATTCTGTGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133370.2-1971s21c1
Sequence:CCGGCACCAGAGACCAGGGTATTTACTCGAGTAAATACCCTGGTCTCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133370.2-2393s21c1
Sequence:CCGGGCGAGATAGAGGACGTGATAGCTCGAGCTATCACGTCCTCTATCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_133370.2-713s21c1
Sequence:CCGGTGCCTCCAGAGAACCTTATAACTCGAGTTATAAGGTTCTCTGGAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_133370.2-1638s21c1
Sequence:CCGGTGGATTTGCAGGCGTGAATTACTCGAGTAATTCACGCCTGCAAATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133370
VALIDATED
YTHDC1 MISSION shRNA Lentiviral Transduction Particles
YTH domain containing 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000147357    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133370.1-2622s1c1
Sequence:CCGGGCAGTATCATAAGAACTGGAACTCGAGTTCCAGTTCTTATGATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257171    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133370.2-3510s21c1
Sequence:CCGGCTGATCACAGAATCGTTTATTCTCGAGAATAAACGATTCTGTGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133370.2-1971s21c1
Sequence:CCGGCACCAGAGACCAGGGTATTTACTCGAGTAAATACCCTGGTCTCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133370.2-2393s21c1
Sequence:CCGGGCGAGATAGAGGACGTGATAGCTCGAGCTATCACGTCCTCTATCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_133370.2-713s21c1
Sequence:CCGGTGCCTCCAGAGAACCTTATAACTCGAGTTATAAGGTTCTCTGGAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_133370.2-1638s21c1
Sequence:CCGGTGGATTTGCAGGCGTGAATTACTCGAGTAATTCACGCCTGCAAATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177680
VALIDATED
YTHDC1 MISSION shRNA Bacterial Glycerol Stock
YTH domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177680.3-265s21c1
Sequence:CCGGTCCATTCAAGACAATTGATTTCTCGAGAAATCAATTGTCTTGAATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177680.3-2265s21c1
Sequence:CCGGAGAGGTCGTTATCGAAGATAACTCGAGTTATCTTCGATAACGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246501    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_177680.3-2714s21c1
Sequence:CCGGGTATGATGGTTTGACTATATGCTCGAGCATATAGTCAAACCATCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_177680.3-2069s21c1
Sequence:CCGGTGATATGAGGGTCGATGATTTCTCGAGAAATCATCGACCCTCATATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_177680.3-1416s21c1
Sequence:CCGGTGGATTTGCAGGCGTGAATTACTCGAGTAATTCACGCCTGCAAATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177680
VALIDATED
YTHDC1 MISSION shRNA shRNA Plasmid DNA
YTH domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177680.3-265s21c1
Sequence:CCGGTCCATTCAAGACAATTGATTTCTCGAGAAATCAATTGTCTTGAATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177680.3-2265s21c1
Sequence:CCGGAGAGGTCGTTATCGAAGATAACTCGAGTTATCTTCGATAACGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246501    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_177680.3-2714s21c1
Sequence:CCGGGTATGATGGTTTGACTATATGCTCGAGCATATAGTCAAACCATCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_177680.3-2069s21c1
Sequence:CCGGTGATATGAGGGTCGATGATTTCTCGAGAAATCATCGACCCTCATATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_177680.3-1416s21c1
Sequence:CCGGTGGATTTGCAGGCGTGAATTACTCGAGTAATTCACGCCTGCAAATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177680
VALIDATED
YTHDC1 MISSION shRNA Lentiviral Transduction Particles
YTH domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177680.3-265s21c1
Sequence:CCGGTCCATTCAAGACAATTGATTTCTCGAGAAATCAATTGTCTTGAATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177680.3-2265s21c1
Sequence:CCGGAGAGGTCGTTATCGAAGATAACTCGAGTTATCTTCGATAACGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246501    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_177680.3-2714s21c1
Sequence:CCGGGTATGATGGTTTGACTATATGCTCGAGCATATAGTCAAACCATCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_177680.3-2069s21c1
Sequence:CCGGTGATATGAGGGTCGATGATTTCTCGAGAAATCATCGACCCTCATATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_177680.3-1416s21c1
Sequence:CCGGTGGATTTGCAGGCGTGAATTACTCGAGTAATTCACGCCTGCAAATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks