EMAIL THIS PAGE TO A FRIEND

YTHDC2

YTH domain containing 2

Synonyms: CAHL
UniProtKB ID: Q9H6S0, B2RP66
Gene ID:
Mouse(240255) YTH domain containing 2
Rat(307446) YTH domain containing 2
domestic guinea pig(100718603) YTH domain containing 2
naked mole-rat(101726442) YTH domain containing 2
cow(541024) YTH domain containing 2
sheep(101122526) YTH domain containing 2
chicken(415602) YTH domain containing 2
domestic cat(101099680) YTH domain containing 2
Horse(100064372) YTH domain containing 2
dog(474641) YTH domain containing 2
181 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001163013 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001163013 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001163013 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022828 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022828 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022828 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022828 Rosetta Predictions human pricing
XM_225959 Rosetta Predictions rat pricing
XM_140310 Rosetta Predictions mouse pricing
XM_910737 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022828 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161045 predicted 3008
2 SASI_Hs01_00161046 predicted 4505
3 SASI_Hs01_00161047 predicted 1002
4 SASI_Hs01_00161048 predicted 3073
5 SASI_Hs01_00161051 predicted 2749
6 SASI_Hs02_00356129 predicted 2608
7 SASI_Hs01_00161052 predicted 2763
8 SASI_Hs02_00356130 predicted 3866
9 SASI_Hs02_00356131 predicted 403
10 SASI_Hs01_00161054 predicted 2129
11 SASI_Hs01_00161049 predicted 1864
12 SASI_Hs01_00161050 predicted 2272
13 SASI_Hs01_00161053 predicted 2991
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_225959 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00383270 predicted 792
2 SASI_Rn02_00383271 predicted 555
3 SASI_Rn02_00383272 predicted 588
4 SASI_Rn02_00383273 predicted 412
5 SASI_Rn02_00383274 predicted 583
6 SASI_Rn02_00383275 predicted 700
7 SASI_Rn02_00383276 predicted 436
8 SASI_Rn02_00383277 predicted 573
9 SASI_Rn02_00383278 predicted 525
10 SASI_Rn02_00383279 predicted 537
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_140310 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00220015 predicted 2004
2 SASI_Mm02_00424946 predicted 1726
3 SASI_Mm01_00220016 predicted 3998
4 SASI_Mm01_00220017 predicted 3484
5 SASI_Mm02_00424947 predicted 3889
6 SASI_Mm02_00424948 predicted 1604
7 SASI_Mm01_00220018 predicted 1700
8 SASI_Mm01_00220019 predicted 3165
9 SASI_Mm01_00220021 predicted 4288
10 SASI_Mm01_00220022 predicted 3182
11 SASI_Mm01_00220014 predicted 2829
12 SASI_Mm01_00220020 predicted 1102
13 SASI_Mm01_00220023 predicted 637
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_910737 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00435865 predicted 2000
2 SASI_Mm02_00435866 predicted 1717
3 SASI_Mm02_00435867 predicted 3994
4 SASI_Mm02_00435868 predicted 3490
5 SASI_Mm02_00435869 predicted 3887
6 SASI_Mm02_00435870 predicted 1598
7 SASI_Mm02_00435871 predicted 1695
8 SASI_Mm02_00435872 predicted 3169
9 SASI_Mm02_00435873 predicted 4288
10 SASI_Mm02_00435874 predicted 3174
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001163013
VALIDATED
YTHDC2 MISSION shRNA Bacterial Glycerol Stock
YTH domain containing 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001163013.1-1124s21c1
Sequence:CCGGGTGAACCTCTTCATAAGATATCTCGAGATATCTTATGAAGAGGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001163013.1-3518s21c1
Sequence:CCGGGCTACCATACGAGCAATTATACTCGAGTATAATTGCTCGTATGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001163013.1-2118s21c1
Sequence:CCGGTAATCCTTTCCACCAATATTGCTCGAGCAATATTGGTGGAAAGGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001163013.1-1891s21c1
Sequence:CCGGGATCATGCATCTCCTATATAACTCGAGTTATATAGGAGATGCATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341885    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001163013.1-4460s21c1
Sequence:CCGGGGATTTGAGGCATAGAGTATTCTCGAGAATACTCTATGCCTCAAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001163013
VALIDATED
YTHDC2 MISSION shRNA shRNA Plasmid DNA
YTH domain containing 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001163013.1-1124s21c1
Sequence:CCGGGTGAACCTCTTCATAAGATATCTCGAGATATCTTATGAAGAGGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001163013.1-3518s21c1
Sequence:CCGGGCTACCATACGAGCAATTATACTCGAGTATAATTGCTCGTATGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001163013.1-2118s21c1
Sequence:CCGGTAATCCTTTCCACCAATATTGCTCGAGCAATATTGGTGGAAAGGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001163013.1-1891s21c1
Sequence:CCGGGATCATGCATCTCCTATATAACTCGAGTTATATAGGAGATGCATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341885    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001163013.1-4460s21c1
Sequence:CCGGGGATTTGAGGCATAGAGTATTCTCGAGAATACTCTATGCCTCAAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001163013
VALIDATED
YTHDC2 MISSION shRNA Lentiviral Transduction Particles
YTH domain containing 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001163013.1-1124s21c1
Sequence:CCGGGTGAACCTCTTCATAAGATATCTCGAGATATCTTATGAAGAGGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001163013.1-3518s21c1
Sequence:CCGGGCTACCATACGAGCAATTATACTCGAGTATAATTGCTCGTATGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001163013.1-2118s21c1
Sequence:CCGGTAATCCTTTCCACCAATATTGCTCGAGCAATATTGGTGGAAAGGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001163013.1-1891s21c1
Sequence:CCGGGATCATGCATCTCCTATATAACTCGAGTTATATAGGAGATGCATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341885    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001163013.1-4460s21c1
Sequence:CCGGGGATTTGAGGCATAGAGTATTCTCGAGAATACTCTATGCCTCAAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022828
VALIDATED
YTHDC2 MISSION shRNA Bacterial Glycerol Stock
YTH domain containing 2
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232761    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022828.2-5921s21c1
Sequence:CCGGTGCCTATAGTTCTAGTTATTACTCGAGTAATAACTAGAACTATAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022828.2-3634s21c1
Sequence:CCGGGCTACCATAAGAGCAATTATACTCGAGTATAATTGCTCTTATGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022828.2-3565s21c1
Sequence:CCGGCAGAAGTGGCATAGCTTATTTCTCGAGAAATAAGCTATGCCACTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022828.2-3310s21c1
Sequence:CCGGGCCCATAGAATAGCTAATATTCTCGAGAATATTAGCTATTCTATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022828.2-2045s21c1
Sequence:CCGGATGCTGGTGCAGTACTAATTTCTCGAGAAATTAGTACTGCACCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154178    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022828.2-5263s1c1
Sequence:CCGGCCCTCGTCACATCTCTTATATCTCGAGATATAAGAGATGTGACGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022828.2-604s1c1
Sequence:CCGGCGTACAGAACTTCTGCCTAAACTCGAGTTTAGGCAGAAGTTCTGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153318    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022828.2-1639s1c1
Sequence:CCGGGCTCAGGTCTTTCATCTCATTCTCGAGAATGAGATGAAAGACCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_022828.2-1231s1c1
Sequence:CCGGGCCTTGGATGTAAATCTCTTTCTCGAGAAAGAGATTTACATCCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022828.2-3752s1c1
Sequence:CCGGCCTCATCTTGGAGGTCAAATACTCGAGTATTTGACCTCCAAGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022828.2-3273s1c1
Sequence:CCGGGCCCACAGATTGGCTTATTTACTCGAGTAAATAAGCCAATCTGTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153934    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022828.2-5856s1c1
Sequence:CCGGCCTTCTACTTTCTCTGGGAAACTCGAGTTTCCCAGAGAAAGTAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158315    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022828.2-4027s1c1
Sequence:CCGGCCAAGACCAAACATGCCTGTTCTCGAGAACAGGCATGTTTGGTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_022828.2-4135s1c1
Sequence:CCGGCGGAAGCTAAATCGAGCCTTTCTCGAGAAAGGCTCGATTTAGCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022828
VALIDATED
YTHDC2 MISSION shRNA shRNA Plasmid DNA
YTH domain containing 2
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232761    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022828.2-5921s21c1
Sequence:CCGGTGCCTATAGTTCTAGTTATTACTCGAGTAATAACTAGAACTATAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022828.2-3634s21c1
Sequence:CCGGGCTACCATAAGAGCAATTATACTCGAGTATAATTGCTCTTATGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022828.2-3565s21c1
Sequence:CCGGCAGAAGTGGCATAGCTTATTTCTCGAGAAATAAGCTATGCCACTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022828.2-3310s21c1
Sequence:CCGGGCCCATAGAATAGCTAATATTCTCGAGAATATTAGCTATTCTATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022828.2-2045s21c1
Sequence:CCGGATGCTGGTGCAGTACTAATTTCTCGAGAAATTAGTACTGCACCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154178    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022828.2-5263s1c1
Sequence:CCGGCCCTCGTCACATCTCTTATATCTCGAGATATAAGAGATGTGACGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022828.2-604s1c1
Sequence:CCGGCGTACAGAACTTCTGCCTAAACTCGAGTTTAGGCAGAAGTTCTGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153318    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022828.2-1639s1c1
Sequence:CCGGGCTCAGGTCTTTCATCTCATTCTCGAGAATGAGATGAAAGACCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_022828.2-1231s1c1
Sequence:CCGGGCCTTGGATGTAAATCTCTTTCTCGAGAAAGAGATTTACATCCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022828.2-3752s1c1
Sequence:CCGGCCTCATCTTGGAGGTCAAATACTCGAGTATTTGACCTCCAAGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022828.2-3273s1c1
Sequence:CCGGGCCCACAGATTGGCTTATTTACTCGAGTAAATAAGCCAATCTGTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153934    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022828.2-5856s1c1
Sequence:CCGGCCTTCTACTTTCTCTGGGAAACTCGAGTTTCCCAGAGAAAGTAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158315    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022828.2-4027s1c1
Sequence:CCGGCCAAGACCAAACATGCCTGTTCTCGAGAACAGGCATGTTTGGTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_022828.2-4135s1c1
Sequence:CCGGCGGAAGCTAAATCGAGCCTTTCTCGAGAAAGGCTCGATTTAGCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022828
VALIDATED
YTHDC2 MISSION shRNA Lentiviral Transduction Particles
YTH domain containing 2
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232761    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022828.2-5921s21c1
Sequence:CCGGTGCCTATAGTTCTAGTTATTACTCGAGTAATAACTAGAACTATAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022828.2-3634s21c1
Sequence:CCGGGCTACCATAAGAGCAATTATACTCGAGTATAATTGCTCTTATGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022828.2-3565s21c1
Sequence:CCGGCAGAAGTGGCATAGCTTATTTCTCGAGAAATAAGCTATGCCACTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022828.2-3310s21c1
Sequence:CCGGGCCCATAGAATAGCTAATATTCTCGAGAATATTAGCTATTCTATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022828.2-2045s21c1
Sequence:CCGGATGCTGGTGCAGTACTAATTTCTCGAGAAATTAGTACTGCACCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154178    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022828.2-5263s1c1
Sequence:CCGGCCCTCGTCACATCTCTTATATCTCGAGATATAAGAGATGTGACGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022828.2-604s1c1
Sequence:CCGGCGTACAGAACTTCTGCCTAAACTCGAGTTTAGGCAGAAGTTCTGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153318    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022828.2-1639s1c1
Sequence:CCGGGCTCAGGTCTTTCATCTCATTCTCGAGAATGAGATGAAAGACCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_022828.2-1231s1c1
Sequence:CCGGGCCTTGGATGTAAATCTCTTTCTCGAGAAAGAGATTTACATCCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022828.2-3752s1c1
Sequence:CCGGCCTCATCTTGGAGGTCAAATACTCGAGTATTTGACCTCCAAGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022828.2-3273s1c1
Sequence:CCGGGCCCACAGATTGGCTTATTTACTCGAGTAAATAAGCCAATCTGTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153934    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022828.2-5856s1c1
Sequence:CCGGCCTTCTACTTTCTCTGGGAAACTCGAGTTTCCCAGAGAAAGTAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158315    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022828.2-4027s1c1
Sequence:CCGGCCAAGACCAAACATGCCTGTTCTCGAGAACAGGCATGTTTGGTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_022828.2-4135s1c1
Sequence:CCGGCGGAAGCTAAATCGAGCCTTTCTCGAGAAAGGCTCGATTTAGCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks