EMAIL THIS PAGE TO A FRIEND

YTHDF1

YTH domain family, member 1

Synonyms: C20orf21
Gene ID:
Mouse(228994) YTH domain family 1
Rat(296467) YTH domain family, member 1
Zebrafish(327606) YTH domain family, member 1
Horse(100060217) YTH domain family, member 1
domestic cat(101080625) YTH domain family, member 1
dog(485968) YTH domain family, member 1
chicken(419238) YTH domain family, member 1
cow(538525) YTH domain family, member 1
sheep(101119151) YTH domain family, member 1
naked mole-rat(101711979) YTH domain family, member 1
domestic guinea pig(100733650) YTH domain family, member 1
125 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173761 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173761 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173761 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017798 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017798 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017798 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017798 Rosetta Predictions human pricing
NM_001024756 Rosetta Predictions rat pricing
NM_173761 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017798 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233686 predicted 718
2 SASI_Hs01_00233687 predicted 571
3 SASI_Hs01_00233688 predicted 1603
4 SASI_Hs01_00233689 predicted 1291
5 SASI_Hs01_00233690 predicted 1875
6 SASI_Hs01_00233691 predicted 1777
7 SASI_Hs01_00233692 predicted 1937
8 SASI_Hs01_00233693 predicted 553
9 SASI_Hs01_00233694 predicted 1500
10 SASI_Hs01_00233695 predicted 1742
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024756 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00110314 predicted 1556
2 SASI_Rn01_00110316 predicted 1268
3 SASI_Rn01_00110317 predicted 705
4 SASI_Rn01_00110318 predicted 1080
5 SASI_Rn01_00110319 predicted 1631
6 SASI_Rn01_00110320 predicted 1577
7 SASI_Rn01_00110321 predicted 1188
8 SASI_Rn01_00110322 predicted 1252
9 SASI_Rn01_00110323 predicted 1181
10 SASI_Rn02_00202634 predicted 217
11 SASI_Rn01_00110315 predicted 330
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173761 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00078555 predicted 407
2 SASI_Mm01_00078556 predicted 1726
3 SASI_Mm01_00078557 predicted 1264
4 SASI_Mm01_00078558 predicted 1350
5 SASI_Mm01_00078559 predicted 805
6 SASI_Mm01_00078560 predicted 1163
7 SASI_Mm01_00078561 predicted 1268
8 SASI_Mm01_00078562 predicted 1337
9 SASI_Mm01_00078564 predicted 495
10 SASI_Mm02_00345413 predicted 1673
11 SASI_Mm01_00078563 predicted 1817
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173761
VALIDATED
YTHDF1 MISSION shRNA Bacterial Glycerol Stock
YTH domain family, member 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071888    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173761.3-2561s1c1
Sequence:CCGGGCAAGGAACTAGAAGGTGTTTCTCGAGAAACACCTTCTAGTTCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_173761.3-308s1c1
Sequence:CCGGGCAGTTCATGACAATGACTTTCTCGAGAAAGTCATTGTCATGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_173761.3-1783s1c1
Sequence:CCGGGCTGAAGATTATCGCTTCCTACTCGAGTAGGAAGCGATAATCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173761.3-672s1c1
Sequence:CCGGGCAGTTACACTTACCCACCTACTCGAGTAGGTGGGTAAGTGTAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_173761.3-1717s1c1
Sequence:CCGGCGACAACAAACCTGTCACAAACTCGAGTTTGTGACAGGTTTGTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348503    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_173761.3-2012s21c1
Sequence:CCGGGGGTTGATTGTTGCATCTTTACTCGAGTAAAGATGCAACAATCAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_173761.3-571s21c1
Sequence:CCGGTTACCAGCACAGGTTTAATTTCTCGAGAAATTAAACCTGTGCTGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_173761.3-1783s21c1
Sequence:CCGGGCTGAAGATTATCGCTTCCTACTCGAGTAGGAAGCGATAATCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173761.3-344s21c1
Sequence:CCGGGGACAGTCCAATCCGAGTAACCTCGAGGTTACTCGGATTGGACTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_173761.3-1346s21c1
Sequence:CCGGGCCCACAGCTATAACCCTAAACTCGAGTTTAGGGTTATAGCTGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173761
VALIDATED
YTHDF1 MISSION shRNA shRNA Plasmid DNA
YTH domain family, member 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071888    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173761.3-2561s1c1
Sequence:CCGGGCAAGGAACTAGAAGGTGTTTCTCGAGAAACACCTTCTAGTTCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_173761.3-308s1c1
Sequence:CCGGGCAGTTCATGACAATGACTTTCTCGAGAAAGTCATTGTCATGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_173761.3-1783s1c1
Sequence:CCGGGCTGAAGATTATCGCTTCCTACTCGAGTAGGAAGCGATAATCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173761.3-672s1c1
Sequence:CCGGGCAGTTACACTTACCCACCTACTCGAGTAGGTGGGTAAGTGTAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_173761.3-1717s1c1
Sequence:CCGGCGACAACAAACCTGTCACAAACTCGAGTTTGTGACAGGTTTGTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348503    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_173761.3-2012s21c1
Sequence:CCGGGGGTTGATTGTTGCATCTTTACTCGAGTAAAGATGCAACAATCAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_173761.3-571s21c1
Sequence:CCGGTTACCAGCACAGGTTTAATTTCTCGAGAAATTAAACCTGTGCTGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_173761.3-1783s21c1
Sequence:CCGGGCTGAAGATTATCGCTTCCTACTCGAGTAGGAAGCGATAATCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173761.3-344s21c1
Sequence:CCGGGGACAGTCCAATCCGAGTAACCTCGAGGTTACTCGGATTGGACTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_173761.3-1346s21c1
Sequence:CCGGGCCCACAGCTATAACCCTAAACTCGAGTTTAGGGTTATAGCTGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173761
VALIDATED
YTHDF1 MISSION shRNA Lentiviral Transduction Particles
YTH domain family, member 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071888    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173761.3-2561s1c1
Sequence:CCGGGCAAGGAACTAGAAGGTGTTTCTCGAGAAACACCTTCTAGTTCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_173761.3-308s1c1
Sequence:CCGGGCAGTTCATGACAATGACTTTCTCGAGAAAGTCATTGTCATGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_173761.3-1783s1c1
Sequence:CCGGGCTGAAGATTATCGCTTCCTACTCGAGTAGGAAGCGATAATCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173761.3-672s1c1
Sequence:CCGGGCAGTTACACTTACCCACCTACTCGAGTAGGTGGGTAAGTGTAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_173761.3-1717s1c1
Sequence:CCGGCGACAACAAACCTGTCACAAACTCGAGTTTGTGACAGGTTTGTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348503    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_173761.3-2012s21c1
Sequence:CCGGGGGTTGATTGTTGCATCTTTACTCGAGTAAAGATGCAACAATCAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_173761.3-571s21c1
Sequence:CCGGTTACCAGCACAGGTTTAATTTCTCGAGAAATTAAACCTGTGCTGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_173761.3-1783s21c1
Sequence:CCGGGCTGAAGATTATCGCTTCCTACTCGAGTAGGAAGCGATAATCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173761.3-344s21c1
Sequence:CCGGGGACAGTCCAATCCGAGTAACCTCGAGGTTACTCGGATTGGACTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_173761.3-1346s21c1
Sequence:CCGGGCCCACAGCTATAACCCTAAACTCGAGTTTAGGGTTATAGCTGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017798
VALIDATED
YTHDF1 MISSION shRNA Bacterial Glycerol Stock
YTH domain family, member 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017798.2-1773s1c1
Sequence:CCGGGCTGGAGAATAACGACAACAACTCGAGTTGTTGTCGTTATTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_017798.2-1428s1c1
Sequence:CCGGCCCGAAAGAGTTTGAGTGGAACTCGAGTTCCACTCAAACTCTTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_017798.2-951s1c1
Sequence:CCGGCGGTGGGACAAATGTGAACATCTCGAGATGTTCACATTTGTCCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_017798.2-356s1c1
Sequence:CCGGGTTCGTTACATCAGAAGGATACTCGAGTATCCTTCTGATGTAACGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017798.2-477s1c1
Sequence:CCGGGCCGTCCATTGGATTTCCTTACTCGAGTAAGGAAATCCAATGGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294207    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017798.3-2462s21c1
Sequence:CCGGATCGGTCTAAAGTGCTAATTTCTCGAGAAATTAGCACTTTAGACCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_017798.3-1428s21c1
Sequence:CCGGCCCGAAAGAGTTTGAGTGGAACTCGAGTTCCACTCAAACTCTTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_017798.3-356s21c1
Sequence:CCGGGTTCGTTACATCAGAAGGATACTCGAGTATCCTTCTGATGTAACGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_017798.3-1493s21c1
Sequence:CCGGACGACATCCACCGCTCCATTACTCGAGTAATGGAGCGGTGGATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_017798.3-454s21c1
Sequence:CCGGCCCTACCTGTCCAGCTATTACCTCGAGGTAATAGCTGGACAGGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017798
VALIDATED
YTHDF1 MISSION shRNA shRNA Plasmid DNA
YTH domain family, member 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017798.2-1773s1c1
Sequence:CCGGGCTGGAGAATAACGACAACAACTCGAGTTGTTGTCGTTATTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_017798.2-1428s1c1
Sequence:CCGGCCCGAAAGAGTTTGAGTGGAACTCGAGTTCCACTCAAACTCTTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_017798.2-951s1c1
Sequence:CCGGCGGTGGGACAAATGTGAACATCTCGAGATGTTCACATTTGTCCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_017798.2-356s1c1
Sequence:CCGGGTTCGTTACATCAGAAGGATACTCGAGTATCCTTCTGATGTAACGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017798.2-477s1c1
Sequence:CCGGGCCGTCCATTGGATTTCCTTACTCGAGTAAGGAAATCCAATGGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294207    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017798.3-2462s21c1
Sequence:CCGGATCGGTCTAAAGTGCTAATTTCTCGAGAAATTAGCACTTTAGACCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_017798.3-1428s21c1
Sequence:CCGGCCCGAAAGAGTTTGAGTGGAACTCGAGTTCCACTCAAACTCTTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_017798.3-356s21c1
Sequence:CCGGGTTCGTTACATCAGAAGGATACTCGAGTATCCTTCTGATGTAACGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_017798.3-1493s21c1
Sequence:CCGGACGACATCCACCGCTCCATTACTCGAGTAATGGAGCGGTGGATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_017798.3-454s21c1
Sequence:CCGGCCCTACCTGTCCAGCTATTACCTCGAGGTAATAGCTGGACAGGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017798
VALIDATED
YTHDF1 MISSION shRNA Lentiviral Transduction Particles
YTH domain family, member 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017798.2-1773s1c1
Sequence:CCGGGCTGGAGAATAACGACAACAACTCGAGTTGTTGTCGTTATTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_017798.2-1428s1c1
Sequence:CCGGCCCGAAAGAGTTTGAGTGGAACTCGAGTTCCACTCAAACTCTTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_017798.2-951s1c1
Sequence:CCGGCGGTGGGACAAATGTGAACATCTCGAGATGTTCACATTTGTCCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_017798.2-356s1c1
Sequence:CCGGGTTCGTTACATCAGAAGGATACTCGAGTATCCTTCTGATGTAACGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017798.2-477s1c1
Sequence:CCGGGCCGTCCATTGGATTTCCTTACTCGAGTAAGGAAATCCAATGGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294207    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017798.3-2462s21c1
Sequence:CCGGATCGGTCTAAAGTGCTAATTTCTCGAGAAATTAGCACTTTAGACCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_017798.3-1428s21c1
Sequence:CCGGCCCGAAAGAGTTTGAGTGGAACTCGAGTTCCACTCAAACTCTTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_017798.3-356s21c1
Sequence:CCGGGTTCGTTACATCAGAAGGATACTCGAGTATCCTTCTGATGTAACGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_017798.3-1493s21c1
Sequence:CCGGACGACATCCACCGCTCCATTACTCGAGTAATGGAGCGGTGGATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_017798.3-454s21c1
Sequence:CCGGCCCTACCTGTCCAGCTATTACCTCGAGGTAATAGCTGGACAGGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks