EMAIL THIS PAGE TO A FRIEND

YTHDF2

YTH domain family, member 2

Synonyms: HGRG8 NY-REN-2
Gene ID:
Human(51441) Summary: This gene encodes a member of the YTH (YT521-B homology) superfamily containing YTH domain. The YTH domain is typical for the eukaryotes and is particularly abundant in plants. The YTH domain is usually located in the middle of the protein sequence and may function in binding to RNA. In addition to a YTH domain, this protein has a proline rich region which may be involved in signal transduction. An Alu-rich domain has been identified in one of the introns of this gene, which is thought to be associated with human longevity. In addition, reciprocal translocations between this gene and the Runx1 (AML1) gene on chromosome 21 has been observed in patients with acute myeloid leukemia. This gene was initially mapped to chromosome 14, which was later turned out to be a pseudogene. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Oct 2012]
Mouse(213541) YTH domain family 2
Rat(313053) YTH domain family, member 2
chicken(419583) YTH domain family, member 2
dog(478161) YTH domain family, member 2
domestic cat(101088596) YTH domain family, member 2
domestic guinea pig(100733512) YTH domain family, member 2
naked mole-rat(101721610) YTH domain family, member 2
Domestic Rabbit(100351518) YTH domain family, member 2
cow(541050) YTH domain family, member 2
sheep(101122840) YTH domain family, member 2
120 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016258 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016258 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016258 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145393 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145393 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145393 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016258 Rosetta Predictions human pricing
NM_001047099 Rosetta Predictions rat pricing
NM_145393 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016258 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133214 predicted 1826
2 SASI_Hs01_00133215 predicted 1761
3 SASI_Hs01_00133216 predicted 1663
4 SASI_Hs01_00133218 predicted 1145
5 SASI_Hs02_00349138 predicted 1892
6 SASI_Hs02_00349139 predicted 2042
7 SASI_Hs02_00349140 predicted 2023
8 SASI_Hs02_00349141 predicted 1070
9 SASI_Hs01_00133222 predicted 1753
10 SASI_Hs01_00133223 predicted 968
11 SASI_Hs01_00133217 predicted 1818
12 SASI_Hs01_00133219 predicted 352
13 SASI_Hs01_00133220 predicted 295
14 SASI_Hs01_00133221 predicted 294
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047099 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205924 predicted 1328
2 SASI_Rn02_00205925 predicted 1320
3 SASI_Rn02_00205926 predicted 592
4 SASI_Rn02_00205927 predicted 841
5 SASI_Rn02_00205928 predicted 786
6 SASI_Rn02_00205929 predicted 316
7 SASI_Rn02_00205930 predicted 1433
8 SASI_Rn02_00205931 predicted 693
9 SASI_Rn02_00205932 predicted 251
10 SASI_Rn02_00205933 predicted 1697
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145393 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00340721 predicted 1494
2 SASI_Mm01_00124479 predicted 870
3 SASI_Mm01_00124481 predicted 1010
4 SASI_Mm01_00124482 predicted 960
5 SASI_Mm01_00124483 predicted 922
6 SASI_Mm01_00124484 predicted 422
7 SASI_Mm01_00124486 predicted 789
8 SASI_Mm02_00340722 predicted 1861
9 SASI_Mm01_00124487 predicted 1259
10 SASI_Mm01_00124488 predicted 737
11 SASI_Mm01_00124480 predicted 1501
12 SASI_Mm01_00124485 predicted 494
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016258
YTHDF2 MISSION shRNA Bacterial Glycerol Stock
YTH domain family, member 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016258.2-1747s21c1
Sequence:CCGGGCTACTCTGAGGACGATATTCCTCGAGGAATATCGTCCTCAGAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016258.2-1674s21c1
Sequence:CCGGCGGTCCATTAATAACTATAACCTCGAGGTTATAGTTATTAATGGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016258.2-936s21c1
Sequence:CCGGTCTGGATATAGTAGCAATTATCTCGAGATAATTGCTACTATATCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254410    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016258.2-2854s21c1
Sequence:CCGGTACTGATTAAGTCAGGATTAACTCGAGTTAATCCTGACTTAATCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016258.2-615s21c1
Sequence:CCGGCCACAGGCAAGGCCCAATAATCTCGAGATTATTGGGCCTTGCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016258.1-229s1c1
Sequence:CCGGGATGGATTAAACGATGATGATCTCGAGATCATCATCGTTTAATCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168709    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016258.1-1816s1c1
Sequence:CCGGGACTTCTCACACTATGAGAAACTCGAGTTTCTCATAGTGTGAGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168751    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016258.1-2007s1c1
Sequence:CCGGGCAGACTTGCAGTTTAAGTATCTCGAGATACTTAAACTGCAAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016258
YTHDF2 MISSION shRNA shRNA Plasmid DNA
YTH domain family, member 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016258.2-1747s21c1
Sequence:CCGGGCTACTCTGAGGACGATATTCCTCGAGGAATATCGTCCTCAGAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016258.2-1674s21c1
Sequence:CCGGCGGTCCATTAATAACTATAACCTCGAGGTTATAGTTATTAATGGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016258.2-936s21c1
Sequence:CCGGTCTGGATATAGTAGCAATTATCTCGAGATAATTGCTACTATATCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254410    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016258.2-2854s21c1
Sequence:CCGGTACTGATTAAGTCAGGATTAACTCGAGTTAATCCTGACTTAATCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016258.2-615s21c1
Sequence:CCGGCCACAGGCAAGGCCCAATAATCTCGAGATTATTGGGCCTTGCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016258.1-229s1c1
Sequence:CCGGGATGGATTAAACGATGATGATCTCGAGATCATCATCGTTTAATCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168709    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016258.1-1816s1c1
Sequence:CCGGGACTTCTCACACTATGAGAAACTCGAGTTTCTCATAGTGTGAGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168751    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016258.1-2007s1c1
Sequence:CCGGGCAGACTTGCAGTTTAAGTATCTCGAGATACTTAAACTGCAAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016258
YTHDF2 MISSION shRNA Lentiviral Transduction Particles
YTH domain family, member 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016258.2-1747s21c1
Sequence:CCGGGCTACTCTGAGGACGATATTCCTCGAGGAATATCGTCCTCAGAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016258.2-1674s21c1
Sequence:CCGGCGGTCCATTAATAACTATAACCTCGAGGTTATAGTTATTAATGGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016258.2-936s21c1
Sequence:CCGGTCTGGATATAGTAGCAATTATCTCGAGATAATTGCTACTATATCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254410    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016258.2-2854s21c1
Sequence:CCGGTACTGATTAAGTCAGGATTAACTCGAGTTAATCCTGACTTAATCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016258.2-615s21c1
Sequence:CCGGCCACAGGCAAGGCCCAATAATCTCGAGATTATTGGGCCTTGCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016258.1-229s1c1
Sequence:CCGGGATGGATTAAACGATGATGATCTCGAGATCATCATCGTTTAATCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168709    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016258.1-1816s1c1
Sequence:CCGGGACTTCTCACACTATGAGAAACTCGAGTTTCTCATAGTGTGAGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168751    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016258.1-2007s1c1
Sequence:CCGGGCAGACTTGCAGTTTAAGTATCTCGAGATACTTAAACTGCAAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145393
VALIDATED
YTHDF2 MISSION shRNA Bacterial Glycerol Stock
YTH domain family, member 2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000176726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145393.2-1874s1c1
Sequence:CCGGCTAGAGAACAACGAGAATAAACTCGAGTTTATTCTCGTTGTTCTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145393.2-1811s1c1
Sequence:CCGGCGTTTCGATGTCAGATGGATTCTCGAGAATCCATCTGACATCGAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145393.2-576s1c1
Sequence:CCGGCCATGCCCTATCTAACTTCTTCTCGAGAAGAAGTTAGATAGGGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197932    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145393.2-2188s1c1
Sequence:CCGGGCAAACTTGCAGTTTATGTATCTCGAGATACATAAACTGCAAGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145393
VALIDATED
YTHDF2 MISSION shRNA shRNA Plasmid DNA
YTH domain family, member 2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000176726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145393.2-1874s1c1
Sequence:CCGGCTAGAGAACAACGAGAATAAACTCGAGTTTATTCTCGTTGTTCTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145393.2-1811s1c1
Sequence:CCGGCGTTTCGATGTCAGATGGATTCTCGAGAATCCATCTGACATCGAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145393.2-576s1c1
Sequence:CCGGCCATGCCCTATCTAACTTCTTCTCGAGAAGAAGTTAGATAGGGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197932    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145393.2-2188s1c1
Sequence:CCGGGCAAACTTGCAGTTTATGTATCTCGAGATACATAAACTGCAAGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145393
VALIDATED
YTHDF2 MISSION shRNA Lentiviral Transduction Particles
YTH domain family, member 2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000176726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145393.2-1874s1c1
Sequence:CCGGCTAGAGAACAACGAGAATAAACTCGAGTTTATTCTCGTTGTTCTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145393.2-1811s1c1
Sequence:CCGGCGTTTCGATGTCAGATGGATTCTCGAGAATCCATCTGACATCGAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145393.2-576s1c1
Sequence:CCGGCCATGCCCTATCTAACTTCTTCTCGAGAAGAAGTTAGATAGGGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197932    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145393.2-2188s1c1
Sequence:CCGGGCAAACTTGCAGTTTATGTATCTCGAGATACATAAACTGCAAGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks