EMAIL THIS PAGE TO A FRIEND

YTHDF3

YTH domain family, member 3

UniProtKB ID: Q7Z739, B3KXL4, Q63Z37, Q659A3
Gene ID:
Human(253943) Summary: This gene encodes a member of the YTH (YT521-B homology) domain protein family. The YTH domain is common in eukaryotes, is often found in the middle of the protein sequence, and may function in binding to RNA. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2013]
Mouse(229096) YTH domain family 3
Rat(361920) YTH domain family, member 3
Zebrafish(334191) YTH domain family 3
chicken(421145) YTH domain family, member 3
domestic cat(101101190) YTH domain family, member 3
dog(486970) YTH domain family, member 3
cow(519708) YTH domain family, member 3
sheep(101118962) YTH domain family, member 3
Domestic Rabbit(100350319) YTH domain family, member 3
naked mole-rat(101722275) YTH domain family, member 3
domestic guinea pig(100719190) YTH domain family, member 3
250 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1306450 ANTI-YTHD3 (CENTER) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB2102735 Anti-YTHDF3 (ab1) antibody produced in rabbit affinity isolated antibody zebrafish, canine, human, horse, bovine, rabbit, rat, mouse, guinea pig
western blot pricing
SAB2102736 Anti-YTHDF3 (ab2) antibody produced in rabbit affinity isolated antibody, lyophilized powder rat, zebrafish, canine, mouse, rabbit, bovine, human, horse, chicken
western blot pricing
SAB2108258 Anti-YTHDF3 antibody produced in rabbit affinity isolated antibody zebrafish, canine, human, mouse, bovine, horse, rabbit, guinea pig, rat
western blot pricing
HPA048703 Anti-YTHDF3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172677 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172677 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172677 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152758 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152758 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152758 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU045501 MISSION® esiRNA esiRNA targeting mouse Ythdf3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152758 Rosetta Predictions human pricing
NM_001108546 Rosetta Predictions rat pricing
NM_172677 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152758 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202277 predicted 1050
2 SASI_Hs01_00202278 predicted 1902
3 SASI_Hs02_00366688 predicted 1824
4 SASI_Hs02_00366689 predicted 392
5 SASI_Hs01_00202279 predicted 827
6 SASI_Hs01_00202282 predicted 606
7 SASI_Hs01_00202283 predicted 590
8 SASI_Hs01_00202284 predicted 1625
9 SASI_Hs01_00202285 predicted 447
10 SASI_Hs02_00366690 predicted 1712
11 SASI_Hs01_00202280 predicted 443
12 SASI_Hs01_00202281 predicted 388
13 SASI_Hs01_00202286 predicted 802
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108546 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239709 predicted 1334
2 SASI_Rn02_00239710 predicted 1384
3 SASI_Rn02_00239711 predicted 1807
4 SASI_Rn02_00239712 predicted 429
5 SASI_Rn02_00239713 predicted 1991
6 SASI_Rn02_00239714 predicted 1831
7 SASI_Rn02_00239715 predicted 789
8 SASI_Rn02_00239716 predicted 1556
9 SASI_Rn02_00239717 predicted 1677
10 SASI_Rn02_00239718 predicted 752
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172677 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00174643 predicted 1416
2 SASI_Mm01_00174644 predicted 1376
3 SASI_Mm02_00344418 predicted 1522
4 SASI_Mm01_00174645 predicted 2028
5 SASI_Mm01_00174646 predicted 1851
6 SASI_Mm01_00174647 predicted 467
7 SASI_Mm01_00174648 predicted 819
8 SASI_Mm01_00174649 predicted 1593
9 SASI_Mm01_00174650 predicted 1714
10 SASI_Mm02_00344419 predicted 786
11 SASI_Mm01_00174641 predicted 2087
12 SASI_Mm01_00174642 predicted 557
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172677
VALIDATED
YTHDF3 MISSION shRNA Bacterial Glycerol Stock
YTH domain family, member 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000191772    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172677.2-2097s1c1
Sequence:CCGGGCCTAATAAGTCAAAGAAGATCTCGAGATCTTCTTTGACTTATTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172677.2-983s1c1
Sequence:CCGGCCAACTTCTTGGGCTGCTATTCTCGAGAATAGCAGCCCAAGAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172677.2-1628s1c1
Sequence:CCGGGCAGCTTATCGTTCCCTGAATCTCGAGATTCAGGGAACGATAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172677.2-1815s1c1
Sequence:CCGGCCAATAACCAATTACGACATACTCGAGTATGTCGTAATTGGTTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172677.2-369s1c1
Sequence:CCGGGCCAGACAAATCAGAAATATACTCGAGTATATTTCTGATTTGTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172677.3-1883s21c1
Sequence:CCGGCAATAACCAATTACGACATATCTCGAGATATGTCGTAATTGGTTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172677.3-497s21c1
Sequence:CCGGACCAATGTCAGATCCATATATCTCGAGATATATGGATCTGACATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329408    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172677.3-2110s21c1
Sequence:CCGGCGTGTGGAGATGTCCTATTAACTCGAGTTAATAGGACATCTCCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172677.3-857s21c1
Sequence:CCGGGGCCGGATTTGGCAATGATACCTCGAGGTATCATTGCCAAATCCGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172677.3-1830s21c1
Sequence:CCGGGATAAGTGGAAGGGCAAATTTCTCGAGAAATTTGCCCTTCCACTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172677
VALIDATED
YTHDF3 MISSION shRNA shRNA Plasmid DNA
YTH domain family, member 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000191772    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172677.2-2097s1c1
Sequence:CCGGGCCTAATAAGTCAAAGAAGATCTCGAGATCTTCTTTGACTTATTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172677.2-983s1c1
Sequence:CCGGCCAACTTCTTGGGCTGCTATTCTCGAGAATAGCAGCCCAAGAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172677.2-1628s1c1
Sequence:CCGGGCAGCTTATCGTTCCCTGAATCTCGAGATTCAGGGAACGATAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172677.2-1815s1c1
Sequence:CCGGCCAATAACCAATTACGACATACTCGAGTATGTCGTAATTGGTTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172677.2-369s1c1
Sequence:CCGGGCCAGACAAATCAGAAATATACTCGAGTATATTTCTGATTTGTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172677.3-1883s21c1
Sequence:CCGGCAATAACCAATTACGACATATCTCGAGATATGTCGTAATTGGTTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172677.3-497s21c1
Sequence:CCGGACCAATGTCAGATCCATATATCTCGAGATATATGGATCTGACATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329408    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172677.3-2110s21c1
Sequence:CCGGCGTGTGGAGATGTCCTATTAACTCGAGTTAATAGGACATCTCCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172677.3-857s21c1
Sequence:CCGGGGCCGGATTTGGCAATGATACCTCGAGGTATCATTGCCAAATCCGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172677.3-1830s21c1
Sequence:CCGGGATAAGTGGAAGGGCAAATTTCTCGAGAAATTTGCCCTTCCACTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172677
VALIDATED
YTHDF3 MISSION shRNA Lentiviral Transduction Particles
YTH domain family, member 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000191772    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172677.2-2097s1c1
Sequence:CCGGGCCTAATAAGTCAAAGAAGATCTCGAGATCTTCTTTGACTTATTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172677.2-983s1c1
Sequence:CCGGCCAACTTCTTGGGCTGCTATTCTCGAGAATAGCAGCCCAAGAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172677.2-1628s1c1
Sequence:CCGGGCAGCTTATCGTTCCCTGAATCTCGAGATTCAGGGAACGATAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172677.2-1815s1c1
Sequence:CCGGCCAATAACCAATTACGACATACTCGAGTATGTCGTAATTGGTTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172677.2-369s1c1
Sequence:CCGGGCCAGACAAATCAGAAATATACTCGAGTATATTTCTGATTTGTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172677.3-1883s21c1
Sequence:CCGGCAATAACCAATTACGACATATCTCGAGATATGTCGTAATTGGTTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172677.3-497s21c1
Sequence:CCGGACCAATGTCAGATCCATATATCTCGAGATATATGGATCTGACATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329408    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172677.3-2110s21c1
Sequence:CCGGCGTGTGGAGATGTCCTATTAACTCGAGTTAATAGGACATCTCCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172677.3-857s21c1
Sequence:CCGGGGCCGGATTTGGCAATGATACCTCGAGGTATCATTGCCAAATCCGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172677.3-1830s21c1
Sequence:CCGGGATAAGTGGAAGGGCAAATTTCTCGAGAAATTTGCCCTTCCACTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152758
VALIDATED
YTHDF3 MISSION shRNA Bacterial Glycerol Stock
YTH domain family, member 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172353    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152758.2-687s1c1
Sequence:CCGGCAAGTGGATCTCAGGGACAATCTCGAGATTGTCCCTGAGATCCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152758.2-310s1c1
Sequence:CCGGGCAAGGAAATAAAGTTTCAGTCTCGAGACTGAAACTTTATTTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152758.2-711s1c1
Sequence:CCGGCACAAAGTTCTGCTTATAGTACTCGAGTACTATAAGCAGAACTTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152758.2-578s1c1
Sequence:CCGGCCAGATGGTGTATTTAGTCAACTCGAGTTGACTAAATACACCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152758.4-1854s21c1
Sequence:CCGGATAACCAATTACGGCATATTCCTCGAGGAATATGCCGTAATTGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152758.4-1753s21c1
Sequence:CCGGGAAGTCTGTTGTGGACTATAACTCGAGTTATAGTCCACAACAGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152758.4-1799s21c1
Sequence:CCGGGATAAGTGGAAGGGCAAATTTCTCGAGAAATTTGCCCTTCCACTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365173    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152758.4-2136s21c1
Sequence:CCGGTAAGTCAAAGAAGACGTATTACTCGAGTAATACGTCTTCTTTGACTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152758.4-598s21c1
Sequence:CCGGTAATGGAGAACATCACTATATCTCGAGATATAGTGATGTTCTCCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152758.4-1584s21c1
Sequence:CCGGGCTACTCTGAGGATGACATACCTCGAGGTATGTCATCCTCAGAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152758
VALIDATED
YTHDF3 MISSION shRNA shRNA Plasmid DNA
YTH domain family, member 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172353    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152758.2-687s1c1
Sequence:CCGGCAAGTGGATCTCAGGGACAATCTCGAGATTGTCCCTGAGATCCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152758.2-310s1c1
Sequence:CCGGGCAAGGAAATAAAGTTTCAGTCTCGAGACTGAAACTTTATTTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152758.2-711s1c1
Sequence:CCGGCACAAAGTTCTGCTTATAGTACTCGAGTACTATAAGCAGAACTTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152758.2-578s1c1
Sequence:CCGGCCAGATGGTGTATTTAGTCAACTCGAGTTGACTAAATACACCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152758.4-1854s21c1
Sequence:CCGGATAACCAATTACGGCATATTCCTCGAGGAATATGCCGTAATTGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152758.4-1753s21c1
Sequence:CCGGGAAGTCTGTTGTGGACTATAACTCGAGTTATAGTCCACAACAGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152758.4-1799s21c1
Sequence:CCGGGATAAGTGGAAGGGCAAATTTCTCGAGAAATTTGCCCTTCCACTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365173    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152758.4-2136s21c1
Sequence:CCGGTAAGTCAAAGAAGACGTATTACTCGAGTAATACGTCTTCTTTGACTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152758.4-598s21c1
Sequence:CCGGTAATGGAGAACATCACTATATCTCGAGATATAGTGATGTTCTCCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152758.4-1584s21c1
Sequence:CCGGGCTACTCTGAGGATGACATACCTCGAGGTATGTCATCCTCAGAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152758
VALIDATED
YTHDF3 MISSION shRNA Lentiviral Transduction Particles
YTH domain family, member 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172353    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152758.2-687s1c1
Sequence:CCGGCAAGTGGATCTCAGGGACAATCTCGAGATTGTCCCTGAGATCCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152758.2-310s1c1
Sequence:CCGGGCAAGGAAATAAAGTTTCAGTCTCGAGACTGAAACTTTATTTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152758.2-711s1c1
Sequence:CCGGCACAAAGTTCTGCTTATAGTACTCGAGTACTATAAGCAGAACTTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152758.2-578s1c1
Sequence:CCGGCCAGATGGTGTATTTAGTCAACTCGAGTTGACTAAATACACCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152758.4-1854s21c1
Sequence:CCGGATAACCAATTACGGCATATTCCTCGAGGAATATGCCGTAATTGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152758.4-1753s21c1
Sequence:CCGGGAAGTCTGTTGTGGACTATAACTCGAGTTATAGTCCACAACAGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152758.4-1799s21c1
Sequence:CCGGGATAAGTGGAAGGGCAAATTTCTCGAGAAATTTGCCCTTCCACTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365173    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152758.4-2136s21c1
Sequence:CCGGTAAGTCAAAGAAGACGTATTACTCGAGTAATACGTCTTCTTTGACTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152758.4-598s21c1
Sequence:CCGGTAATGGAGAACATCACTATATCTCGAGATATAGTGATGTTCTCCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152758.4-1584s21c1
Sequence:CCGGGCTACTCTGAGGATGACATACCTCGAGGTATGTCATCCTCAGAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks