EMAIL THIS PAGE TO A FRIEND

YWHAB

tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide

Synonyms: GW128 HS1 KCIP-1 YWHAA
UniProtKB ID: P31946, A8K9K2, E1P616
Gene ID:
Human(7529) Summary: This gene encodes a protein belonging to the 14-3-3 family of proteins, members of which mediate signal transduction by binding to phosphoserine-containing proteins. This highly conserved protein family is found in both plants and mammals. The encoded protein has been shown to interact with RAF1 and CDC25 phosphatases, suggesting that it may play a role in linking mitogenic signaling and the cell cycle machinery. Two transcript variants, which encode the same protein, have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(54401) tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide
Rat(56011) tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide
chicken(419190) tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide
domestic cat(101091685) tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide
dog(477237) tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide
cow(286863) tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide
sheep(100036763) tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide
sheep(101110165) tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide
domestic guinea pig(100715125) tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide
naked mole-rat(101705080) tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide
157 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018753 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018753 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018753 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003404 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003404 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003404 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003404 Rosetta Predictions human pricing
NM_139323 Rosetta Predictions human pricing
NM_019377 Rosetta Predictions rat pricing
NM_018753 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003404 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024240 predicted 1494
2 SASI_Hs01_00024241 predicted 1433
3 SASI_Hs01_00024242 predicted 1479
4 SASI_Hs01_00024243 predicted 1445
5 SASI_Hs01_00024245 predicted 1487
6 SASI_Hs01_00024246 predicted 866
7 SASI_Hs02_00335595 predicted 793
8 SASI_Hs01_00024247 predicted 731
9 SASI_Hs01_00024249 predicted 624
10 SASI_Hs02_00335596 predicted 661
11 SASI_Hs01_00024244 predicted 1356
12 SASI_Hs01_00024248 predicted 1326
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139323 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173366 predicted 1395
2 SASI_Hs01_00173367 predicted 1334
3 SASI_Hs01_00173368 predicted 1379
4 SASI_Hs01_00173369 predicted 1345
5 SASI_Hs01_00173371 predicted 1386
6 SASI_Hs01_00173372 predicted 772
7 SASI_Hs02_00364300 predicted 703
8 SASI_Hs01_00173373 predicted 642
9 SASI_Hs01_00173375 predicted 526
10 SASI_Hs02_00364301 predicted 564
11 SASI_Hs01_00173370 predicted 1255
12 SASI_Hs01_00173374 predicted 1232
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019377 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049314 predicted 1266
2 SASI_Rn01_00049315 predicted 234
3 SASI_Rn01_00049316 predicted 506
4 SASI_Rn01_00049317 predicted 1311
5 SASI_Rn01_00049319 predicted 222
6 SASI_Rn01_00049320 predicted 678
7 SASI_Rn01_00049321 predicted 697
8 SASI_Rn01_00049322 predicted 470
9 SASI_Rn01_00049323 predicted 485
10 SASI_Rn02_00262412 predicted 344
11 SASI_Rn01_00049318 predicted 334
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018753 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00174478 predicted 757
2 SASI_Mm01_00174479 predicted 541
3 SASI_Mm01_00174480 predicted 997
4 SASI_Mm01_00174481 predicted 249
5 SASI_Mm01_00174482 predicted 795
6 SASI_Mm02_00324040 predicted 959
7 SASI_Mm01_00174483 predicted 936
8 SASI_Mm01_00174484 predicted 559
9 SASI_Mm01_00174485 predicted 589
10 SASI_Mm01_00174486 predicted 681
11 SASI_Mm01_00174487 predicted 709
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018753
YWHAB MISSION shRNA Bacterial Glycerol Stock
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000324030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018753.6-793s21c1
Sequence:CCGGCCTGAATGAAGAGTCTTACAACTCGAGTTGTAAGACTCTTCATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018753.6-247s21c1
Sequence:CCGGTGCAGCTATGAAGGCCGTAACCTCGAGGTTACGGCCTTCATAGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305700    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018753.6-963s21c1
Sequence:CCGGTATGTCCCTTTGTGCGATAAACTCGAGTTTATCGCACAAAGGGACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018753.6-547s21c1
Sequence:CCGGAGACTACTTTAGGTATCTTTCCTCGAGGAAAGATACCTAAAGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018753.6-894s21c1
Sequence:CCGGCTGGAGAGGGAGAGAACTAATCTCGAGATTAGTTCTCTCCCTCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018753.3-690s1c1
Sequence:CCGGGCGCTGAATTTCTCAGTCTTTCTCGAGAAAGACTGAGAAATTCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076398    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018753.3-2198s1c1
Sequence:CCGGCGTCTCAACAAGACCTTAGAACTCGAGTTCTAAGGTCTTGTTGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018753.3-476s1c1
Sequence:CCGGGCTGTTGGACAAATATCTCATCTCGAGATGAGATATTTGTCCAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018753.3-297s1c1
Sequence:CCGGGAGAGGAATCTACTCTCTGTTCTCGAGAACAGAGAGTAGATTCCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018753.3-794s1c1
Sequence:CCGGCCTGAATGAAGAGTCTTACAACTCGAGTTGTAAGACTCTTCATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018753
YWHAB MISSION shRNA shRNA Plasmid DNA
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000324030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018753.6-793s21c1
Sequence:CCGGCCTGAATGAAGAGTCTTACAACTCGAGTTGTAAGACTCTTCATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018753.6-247s21c1
Sequence:CCGGTGCAGCTATGAAGGCCGTAACCTCGAGGTTACGGCCTTCATAGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305700    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018753.6-963s21c1
Sequence:CCGGTATGTCCCTTTGTGCGATAAACTCGAGTTTATCGCACAAAGGGACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018753.6-547s21c1
Sequence:CCGGAGACTACTTTAGGTATCTTTCCTCGAGGAAAGATACCTAAAGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018753.6-894s21c1
Sequence:CCGGCTGGAGAGGGAGAGAACTAATCTCGAGATTAGTTCTCTCCCTCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018753.3-690s1c1
Sequence:CCGGGCGCTGAATTTCTCAGTCTTTCTCGAGAAAGACTGAGAAATTCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076398    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018753.3-2198s1c1
Sequence:CCGGCGTCTCAACAAGACCTTAGAACTCGAGTTCTAAGGTCTTGTTGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018753.3-476s1c1
Sequence:CCGGGCTGTTGGACAAATATCTCATCTCGAGATGAGATATTTGTCCAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018753.3-297s1c1
Sequence:CCGGGAGAGGAATCTACTCTCTGTTCTCGAGAACAGAGAGTAGATTCCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018753.3-794s1c1
Sequence:CCGGCCTGAATGAAGAGTCTTACAACTCGAGTTGTAAGACTCTTCATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018753
YWHAB MISSION shRNA Lentiviral Transduction Particles
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000324030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018753.6-793s21c1
Sequence:CCGGCCTGAATGAAGAGTCTTACAACTCGAGTTGTAAGACTCTTCATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018753.6-247s21c1
Sequence:CCGGTGCAGCTATGAAGGCCGTAACCTCGAGGTTACGGCCTTCATAGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305700    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018753.6-963s21c1
Sequence:CCGGTATGTCCCTTTGTGCGATAAACTCGAGTTTATCGCACAAAGGGACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018753.6-547s21c1
Sequence:CCGGAGACTACTTTAGGTATCTTTCCTCGAGGAAAGATACCTAAAGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018753.6-894s21c1
Sequence:CCGGCTGGAGAGGGAGAGAACTAATCTCGAGATTAGTTCTCTCCCTCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018753.3-690s1c1
Sequence:CCGGGCGCTGAATTTCTCAGTCTTTCTCGAGAAAGACTGAGAAATTCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076398    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018753.3-2198s1c1
Sequence:CCGGCGTCTCAACAAGACCTTAGAACTCGAGTTCTAAGGTCTTGTTGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018753.3-476s1c1
Sequence:CCGGGCTGTTGGACAAATATCTCATCTCGAGATGAGATATTTGTCCAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018753.3-297s1c1
Sequence:CCGGGAGAGGAATCTACTCTCTGTTCTCGAGAACAGAGAGTAGATTCCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018753.3-794s1c1
Sequence:CCGGCCTGAATGAAGAGTCTTACAACTCGAGTTGTAAGACTCTTCATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003404
VALIDATED
YWHAB MISSION shRNA Bacterial Glycerol Stock
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000292150    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003404.3-2773s21c1
Sequence:CCGGCCTCCTTTCTAGCTGAACAAACTCGAGTTTGTTCAGCTAGAAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_003404.3-607s21c1
Sequence:CCGGCCCAATGCTACACAACCAGAACTCGAGTTCTGGTTGTGTAGCATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_003404.3-902s21c1
Sequence:CCGGCGCTGAATGAAGAGTCTTATACTCGAGTATAAGACTCTTCATTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_003404.3-889s21c1
Sequence:CCGGGCTGAATTGGATACGCTGAATCTCGAGATTCAGCGTATCCAATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003404.3-607s1c1
Sequence:CCGGCCCAATGCTACACAACCAGAACTCGAGTTCTGGTTGTGTAGCATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_003404.3-902s1c1
Sequence:CCGGCGCTGAATGAAGAGTCTTATACTCGAGTATAAGACTCTTCATTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_003404.3-889s1c1
Sequence:CCGGGCTGAATTGGATACGCTGAATCTCGAGATTCAGCGTATCCAATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003404.3-608s1c1
Sequence:CCGGCCAATGCTACACAACCAGAAACTCGAGTTTCTGGTTGTGTAGCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078153    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_003404.3-2773s1c1
Sequence:CCGGCCTCCTTTCTAGCTGAACAAACTCGAGTTTGTTCAGCTAGAAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003404
VALIDATED
YWHAB MISSION shRNA shRNA Plasmid DNA
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000292150    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003404.3-2773s21c1
Sequence:CCGGCCTCCTTTCTAGCTGAACAAACTCGAGTTTGTTCAGCTAGAAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_003404.3-607s21c1
Sequence:CCGGCCCAATGCTACACAACCAGAACTCGAGTTCTGGTTGTGTAGCATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_003404.3-902s21c1
Sequence:CCGGCGCTGAATGAAGAGTCTTATACTCGAGTATAAGACTCTTCATTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_003404.3-889s21c1
Sequence:CCGGGCTGAATTGGATACGCTGAATCTCGAGATTCAGCGTATCCAATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003404.3-607s1c1
Sequence:CCGGCCCAATGCTACACAACCAGAACTCGAGTTCTGGTTGTGTAGCATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_003404.3-902s1c1
Sequence:CCGGCGCTGAATGAAGAGTCTTATACTCGAGTATAAGACTCTTCATTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_003404.3-889s1c1
Sequence:CCGGGCTGAATTGGATACGCTGAATCTCGAGATTCAGCGTATCCAATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003404.3-608s1c1
Sequence:CCGGCCAATGCTACACAACCAGAAACTCGAGTTTCTGGTTGTGTAGCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078153    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_003404.3-2773s1c1
Sequence:CCGGCCTCCTTTCTAGCTGAACAAACTCGAGTTTGTTCAGCTAGAAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003404
VALIDATED
YWHAB MISSION shRNA Lentiviral Transduction Particles
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000292150    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003404.3-2773s21c1
Sequence:CCGGCCTCCTTTCTAGCTGAACAAACTCGAGTTTGTTCAGCTAGAAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_003404.3-607s21c1
Sequence:CCGGCCCAATGCTACACAACCAGAACTCGAGTTCTGGTTGTGTAGCATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_003404.3-902s21c1
Sequence:CCGGCGCTGAATGAAGAGTCTTATACTCGAGTATAAGACTCTTCATTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_003404.3-889s21c1
Sequence:CCGGGCTGAATTGGATACGCTGAATCTCGAGATTCAGCGTATCCAATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003404.3-607s1c1
Sequence:CCGGCCCAATGCTACACAACCAGAACTCGAGTTCTGGTTGTGTAGCATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_003404.3-902s1c1
Sequence:CCGGCGCTGAATGAAGAGTCTTATACTCGAGTATAAGACTCTTCATTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_003404.3-889s1c1
Sequence:CCGGGCTGAATTGGATACGCTGAATCTCGAGATTCAGCGTATCCAATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003404.3-608s1c1
Sequence:CCGGCCAATGCTACACAACCAGAAACTCGAGTTTCTGGTTGTGTAGCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078153    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_003404.3-2773s1c1
Sequence:CCGGCCTCCTTTCTAGCTGAACAAACTCGAGTTTGTTCAGCTAGAAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks