EMAIL THIS PAGE TO A FRIEND

YWHAE

tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide

Synonyms: 14-3-3E KCIP-1 MDCR MDS
Gene ID:
Human(7531) Summary: This gene product belongs to the 14-3-3 family of proteins which mediate signal transduction by binding to phosphoserine-containing proteins. This highly conserved protein family is found in both plants and mammals, and this protein is 100% identical to the mouse ortholog. It interacts with CDC25 phosphatases, RAF1 and IRS1 proteins, suggesting its role in diverse biochemical activities related to signal transduction, such as cell division and regulation of insulin sensitivity. It has also been implicated in the pathogenesis of small cell lung cancer. Two transcript variants, one protein-coding and the other non-protein-coding, have been found for this gene. [provided by RefSeq, Aug 2008]
Mouse(22627) tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide
Rat(29753) tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide
chicken(417554) tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide
domestic cat(101101425) tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide
dog(480645) tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide
naked mole-rat(101717238) tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide
domestic guinea pig(100714396) tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide
cow(282125) tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide
sheep(443300) tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide
125 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006761 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006761 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006761 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009536 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009536 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009536 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006761 Rosetta Predictions human pricing
NM_031603 Rosetta Predictions rat pricing
NM_009536 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006761 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00342252 predicted 570
2 SASI_Hs02_00342253 predicted 399
3 SASI_Hs02_00342254 predicted 621
4 SASI_Hs01_00153745 predicted 751
5 SASI_Hs02_00342255 predicted 759
6 SASI_Hs01_00153746 predicted 745
7 SASI_Hs02_00342256 predicted 642
8 SASI_Hs02_00342257 predicted 353
9 SASI_Hs02_00342258 predicted 360
10 SASI_Hs02_00342259 predicted 438
11 SASI_Hs01_00153744 predicted 547
12 SASI_Hs01_00153747 predicted 766
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031603 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081505 predicted 364
2 SASI_Rn01_00081506 predicted 543
3 SASI_Rn01_00081507 predicted 429
4 SASI_Rn02_00264882 predicted 406
5 SASI_Rn01_00081508 predicted 355
6 SASI_Rn01_00081509 predicted 525
7 SASI_Rn01_00081510 predicted 440
8 SASI_Rn01_00081511 predicted 250
9 SASI_Rn01_00081512 predicted 382
10 SASI_Rn01_00081513 predicted 538
11 SASI_Rn01_00081514 predicted 717
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009536 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00124692 predicted 367
2 SASI_Mm01_00124693 predicted 545
3 SASI_Mm01_00124694 predicted 480
4 SASI_Mm01_00124696 predicted 375
5 SASI_Mm01_00124697 predicted 361
6 SASI_Mm02_00316364 predicted 402
7 SASI_Mm01_00124698 predicted 255
8 SASI_Mm01_00124699 predicted 533
9 SASI_Mm01_00124700 predicted 333
10 SASI_Mm01_00124701 predicted 415
11 SASI_Mm01_00124695 predicted 413
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006761
VALIDATED
YWHAE MISSION shRNA Bacterial Glycerol Stock
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_006761.3-736s1c1
Sequence:CCGGCGCTGAGTGAAGAAAGCTATACTCGAGTATAGCTTTCTTCACTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006761.3-622s1c1
Sequence:CCGGGCTTAGGTCTTGCTCTCAATTCTCGAGAATTGAGAGCAAGACCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006761.3-221s1c1
Sequence:CCGGGCTGACAGTTGAAGAAAGAAACTCGAGTTTCTTTCTTCAACTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006761.3-173s1c1
Sequence:CCGGCGACGAAATGGTGGAGTCAATCTCGAGATTGACTCCACCATTTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006761.3-497s1c1
Sequence:CCGGCCACAGGTATCTGGCAGAATTCTCGAGAATTCTGCCAGATACCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_006761.4-775s21c1
Sequence:CCGGCGCTGAGTGAAGAAAGCTATACTCGAGTATAGCTTTCTTCACTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006761.4-212s21c1
Sequence:CCGGCGACGAAATGGTGGAGTCAATCTCGAGATTGACTCCACCATTTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006761.4-536s21c1
Sequence:CCGGCCACAGGTATCTGGCAGAATTCTCGAGAATTCTGCCAGATACCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006761.4-661s21c1
Sequence:CCGGGCTTAGGTCTTGCTCTCAATTCTCGAGAATTGAGAGCAAGACCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006761
VALIDATED
YWHAE MISSION shRNA shRNA Plasmid DNA
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_006761.3-736s1c1
Sequence:CCGGCGCTGAGTGAAGAAAGCTATACTCGAGTATAGCTTTCTTCACTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006761.3-622s1c1
Sequence:CCGGGCTTAGGTCTTGCTCTCAATTCTCGAGAATTGAGAGCAAGACCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006761.3-221s1c1
Sequence:CCGGGCTGACAGTTGAAGAAAGAAACTCGAGTTTCTTTCTTCAACTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006761.3-173s1c1
Sequence:CCGGCGACGAAATGGTGGAGTCAATCTCGAGATTGACTCCACCATTTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006761.3-497s1c1
Sequence:CCGGCCACAGGTATCTGGCAGAATTCTCGAGAATTCTGCCAGATACCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_006761.4-775s21c1
Sequence:CCGGCGCTGAGTGAAGAAAGCTATACTCGAGTATAGCTTTCTTCACTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006761.4-212s21c1
Sequence:CCGGCGACGAAATGGTGGAGTCAATCTCGAGATTGACTCCACCATTTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006761.4-536s21c1
Sequence:CCGGCCACAGGTATCTGGCAGAATTCTCGAGAATTCTGCCAGATACCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006761.4-661s21c1
Sequence:CCGGGCTTAGGTCTTGCTCTCAATTCTCGAGAATTGAGAGCAAGACCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006761
VALIDATED
YWHAE MISSION shRNA Lentiviral Transduction Particles
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_006761.3-736s1c1
Sequence:CCGGCGCTGAGTGAAGAAAGCTATACTCGAGTATAGCTTTCTTCACTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006761.3-622s1c1
Sequence:CCGGGCTTAGGTCTTGCTCTCAATTCTCGAGAATTGAGAGCAAGACCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006761.3-221s1c1
Sequence:CCGGGCTGACAGTTGAAGAAAGAAACTCGAGTTTCTTTCTTCAACTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006761.3-173s1c1
Sequence:CCGGCGACGAAATGGTGGAGTCAATCTCGAGATTGACTCCACCATTTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006761.3-497s1c1
Sequence:CCGGCCACAGGTATCTGGCAGAATTCTCGAGAATTCTGCCAGATACCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_006761.4-775s21c1
Sequence:CCGGCGCTGAGTGAAGAAAGCTATACTCGAGTATAGCTTTCTTCACTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006761.4-212s21c1
Sequence:CCGGCGACGAAATGGTGGAGTCAATCTCGAGATTGACTCCACCATTTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006761.4-536s21c1
Sequence:CCGGCCACAGGTATCTGGCAGAATTCTCGAGAATTCTGCCAGATACCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006761.4-661s21c1
Sequence:CCGGGCTTAGGTCTTGCTCTCAATTCTCGAGAATTGAGAGCAAGACCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009536
YWHAE MISSION shRNA Bacterial Glycerol Stock
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009536.2-1811s1c1
Sequence:CCGGCCAGACATATTTGACAGTATTCTCGAGAATACTGTCAAATATGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009536.2-150s1c1
Sequence:CCGGCGACGAAATGGTGGAATCAATCTCGAGATTGATTCCACCATTTCGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009536.2-802s1c1
Sequence:CCGGGATGGTGAAGAGCAGAATAAACTCGAGTTTATTCTGCTCTTCACCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009536.2-714s1c1
Sequence:CCGGGCTGAGTGAAGAAAGCTATAACTCGAGTTATAGCTTTCTTCACTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009536.2-203s1c1
Sequence:CCGGCAGTTGAAGAACGAAACCTTTCTCGAGAAAGGTTTCGTTCTTCAACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009536.4-899s21c1
Sequence:CCGGAGAATCAGTGAGACGAAATAACTCGAGTTATTTCGTCTCACTGATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009536.4-384s21c1
Sequence:CCGGGATTCGGGAGTACCGGCAAATCTCGAGATTTGCCGGTACTCCCGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009536.4-802s21c1
Sequence:CCGGATGCAGCTGCTACGTGATAACCTCGAGGTTATCACGTAGCAGCTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427753    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009536.4-1173s21c1
Sequence:CCGGTAGGTTCTTTACGACACTAACCTCGAGGTTAGTGTCGTAAAGAACCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009536
YWHAE MISSION shRNA shRNA Plasmid DNA
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009536.2-1811s1c1
Sequence:CCGGCCAGACATATTTGACAGTATTCTCGAGAATACTGTCAAATATGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009536.2-150s1c1
Sequence:CCGGCGACGAAATGGTGGAATCAATCTCGAGATTGATTCCACCATTTCGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009536.2-802s1c1
Sequence:CCGGGATGGTGAAGAGCAGAATAAACTCGAGTTTATTCTGCTCTTCACCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009536.2-714s1c1
Sequence:CCGGGCTGAGTGAAGAAAGCTATAACTCGAGTTATAGCTTTCTTCACTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009536.2-203s1c1
Sequence:CCGGCAGTTGAAGAACGAAACCTTTCTCGAGAAAGGTTTCGTTCTTCAACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009536.4-899s21c1
Sequence:CCGGAGAATCAGTGAGACGAAATAACTCGAGTTATTTCGTCTCACTGATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009536.4-384s21c1
Sequence:CCGGGATTCGGGAGTACCGGCAAATCTCGAGATTTGCCGGTACTCCCGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009536.4-802s21c1
Sequence:CCGGATGCAGCTGCTACGTGATAACCTCGAGGTTATCACGTAGCAGCTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427753    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009536.4-1173s21c1
Sequence:CCGGTAGGTTCTTTACGACACTAACCTCGAGGTTAGTGTCGTAAAGAACCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009536
YWHAE MISSION shRNA Lentiviral Transduction Particles
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009536.2-1811s1c1
Sequence:CCGGCCAGACATATTTGACAGTATTCTCGAGAATACTGTCAAATATGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009536.2-150s1c1
Sequence:CCGGCGACGAAATGGTGGAATCAATCTCGAGATTGATTCCACCATTTCGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009536.2-802s1c1
Sequence:CCGGGATGGTGAAGAGCAGAATAAACTCGAGTTTATTCTGCTCTTCACCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009536.2-714s1c1
Sequence:CCGGGCTGAGTGAAGAAAGCTATAACTCGAGTTATAGCTTTCTTCACTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009536.2-203s1c1
Sequence:CCGGCAGTTGAAGAACGAAACCTTTCTCGAGAAAGGTTTCGTTCTTCAACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009536.4-899s21c1
Sequence:CCGGAGAATCAGTGAGACGAAATAACTCGAGTTATTTCGTCTCACTGATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009536.4-384s21c1
Sequence:CCGGGATTCGGGAGTACCGGCAAATCTCGAGATTTGCCGGTACTCCCGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009536.4-802s21c1
Sequence:CCGGATGCAGCTGCTACGTGATAACCTCGAGGTTATCACGTAGCAGCTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427753    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009536.4-1173s21c1
Sequence:CCGGTAGGTTCTTTACGACACTAACCTCGAGGTTAGTGTCGTAAAGAACCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks