EMAIL THIS PAGE TO A FRIEND

YWHAG

tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide

Synonyms: 14-3-3GAMMA
UniProtKB ID: P61981, O70457, P35214, Q6FH52, Q9UDP2, Q9UN99
Gene ID:
Human(7532) Summary: This gene product belongs to the 14-3-3 family of proteins which mediate signal transduction by binding to phosphoserine-containing proteins. This highly conserved protein family is found in both plants and mammals, and this protein is 100% identical to the rat ortholog. It is induced by growth factors in human vascular smooth muscle cells, and is also highly expressed in skeletal and heart muscles, suggesting an important role for this protein in muscle tissue. It has been shown to interact with RAF1 and protein kinase C, proteins involved in various signal transduction pathways. [provided by RefSeq, Jul 2008]
Mouse(22628) tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide
Rat(56010) tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide
chicken(427820) tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide
dog(489818) tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide
domestic cat(101084156) tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide
cow(286862) tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide
sheep(101116012) tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide
domestic guinea pig(100725300) tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide
naked mole-rat(101716439) tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide
Gene Class: Cytoskeleton
156 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012479 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012479 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012479 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_018871 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018871 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018871 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU055011 MISSION® esiRNA esiRNA targeting mouse Ywhag (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012479 Rosetta Predictions human pricing
NM_019376 Rosetta Predictions rat pricing
NM_018871 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012479 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201707 predicted 1252
2 SASI_Hs01_00201708 predicted 409
3 SASI_Hs01_00201709 predicted 717
4 SASI_Hs01_00201711 predicted 702
5 SASI_Hs01_00201712 predicted 695
6 SASI_Hs01_00201713 predicted 1424
7 SASI_Hs01_00201714 predicted 961
8 SASI_Hs01_00201715 predicted 703
9 SASI_Hs01_00201716 predicted 284
10 SASI_Hs02_00344393 predicted 1390
11 SASI_Hs01_00201710 predicted 1205
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019376 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00099686 predicted 268
2 SASI_Rn02_00262405 predicted 903
3 SASI_Rn02_00262406 predicted 198
4 SASI_Rn02_00262407 predicted 894
5 SASI_Rn01_00099689 predicted 591
6 SASI_Rn01_00099690 predicted 725
7 SASI_Rn02_00262408 predicted 901
8 SASI_Rn02_00262409 predicted 204
9 SASI_Rn02_00262410 predicted 221
10 SASI_Rn02_00262411 predicted 773
11 SASI_Rn01_00099683 predicted 948
12 SASI_Rn01_00099684 predicted 889
13 SASI_Rn01_00099685 predicted 882
14 SASI_Rn01_00099687 predicted 990
15 SASI_Rn01_00099688 predicted 978
16 SASI_Rn01_00099691 predicted 882
17 SASI_Rn01_00099692 predicted 974
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018871 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123772 predicted 831
2 SASI_Mm01_00123773 predicted 1169
3 SASI_Mm01_00123774 predicted 735
4 SASI_Mm01_00123775 predicted 1179
5 SASI_Mm02_00324254 predicted 878
6 SASI_Mm01_00123776 predicted 994
7 SASI_Mm01_00123777 predicted 885
8 SASI_Mm01_00123779 predicted 1174
9 SASI_Mm01_00123780 predicted 1150
10 SASI_Mm01_00123781 predicted 1190
11 SASI_Mm01_00123778 predicted 181
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012479
VALIDATED
YWHAG MISSION shRNA Bacterial Glycerol Stock
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012479.3-423s21c1
Sequence:CCGGAGACATCTGCAGACGGCAATGCTCGAGCATTGCCGTCTGCAGATGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012479.3-338s21c1
Sequence:CCGGGAACGAAACCTTCTGTCTGTGCTCGAGCACAGACAGAAGGTTTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012479.3-310s21c1
Sequence:CCGGAGAGCTGAATGAGCCACTGTCCTCGAGGACAGTGGCTCATTCAGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422138    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012479.3-1419s21c1
Sequence:CCGGAGACATGGAACAGTGTAAATCCTCGAGGATTTACACTGTTCCATGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012479.3-451s21c1
Sequence:CCGGGATTGAGATGGTCCGTGCGTACTCGAGTACGCACGGACCATCTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012479.3-685s21c1
Sequence:CCGGAGCCCACGAGATCAGCAAAGACTCGAGTCTTTGCTGATCTCGTGGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012479.3-466s21c1
Sequence:CCGGTGCGTACCGGGAGAAGATAGACTCGAGTCTATCTTCTCCCGGTACGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012479.3-547s21c1
Sequence:CCGGGAATTGCAGCGAGACCCAGTACTCGAGTACTGGGTCTCGCTGCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426568    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012479.3-1218s21c1
Sequence:CCGGGGAGCTGTCTGTCTCTAATTTCTCGAGAAATTAGAGACAGACAGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078158    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012479.2-2158s1c1
Sequence:CCGGCCCAAGTAATTGTAGGAAGATCTCGAGATCTTCCTACAATTACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012479.2-497s1c1
Sequence:CCGGCCTGCTGGATAACTACCTGATCTCGAGATCAGGTAGTTATCCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012479.2-408s1c1
Sequence:CCGGGACGGCAATGAGAAGAAGATTCTCGAGAATCTTCTTCTCATTGCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012479.2-719s1c1
Sequence:CCGGTCTTAACTACTCCGTCTTCTACTCGAGTAGAAGACGGAGTAGTTAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012479.2-298s1c1
Sequence:CCGGCACTGTCGAATGAGGAACGAACTCGAGTTCGTTCCTCATTCGACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012479
VALIDATED
YWHAG MISSION shRNA shRNA Plasmid DNA
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012479.3-423s21c1
Sequence:CCGGAGACATCTGCAGACGGCAATGCTCGAGCATTGCCGTCTGCAGATGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012479.3-338s21c1
Sequence:CCGGGAACGAAACCTTCTGTCTGTGCTCGAGCACAGACAGAAGGTTTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012479.3-310s21c1
Sequence:CCGGAGAGCTGAATGAGCCACTGTCCTCGAGGACAGTGGCTCATTCAGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422138    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012479.3-1419s21c1
Sequence:CCGGAGACATGGAACAGTGTAAATCCTCGAGGATTTACACTGTTCCATGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012479.3-451s21c1
Sequence:CCGGGATTGAGATGGTCCGTGCGTACTCGAGTACGCACGGACCATCTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012479.3-685s21c1
Sequence:CCGGAGCCCACGAGATCAGCAAAGACTCGAGTCTTTGCTGATCTCGTGGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012479.3-466s21c1
Sequence:CCGGTGCGTACCGGGAGAAGATAGACTCGAGTCTATCTTCTCCCGGTACGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012479.3-547s21c1
Sequence:CCGGGAATTGCAGCGAGACCCAGTACTCGAGTACTGGGTCTCGCTGCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426568    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012479.3-1218s21c1
Sequence:CCGGGGAGCTGTCTGTCTCTAATTTCTCGAGAAATTAGAGACAGACAGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078158    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012479.2-2158s1c1
Sequence:CCGGCCCAAGTAATTGTAGGAAGATCTCGAGATCTTCCTACAATTACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012479.2-497s1c1
Sequence:CCGGCCTGCTGGATAACTACCTGATCTCGAGATCAGGTAGTTATCCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012479.2-408s1c1
Sequence:CCGGGACGGCAATGAGAAGAAGATTCTCGAGAATCTTCTTCTCATTGCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012479.2-719s1c1
Sequence:CCGGTCTTAACTACTCCGTCTTCTACTCGAGTAGAAGACGGAGTAGTTAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012479.2-298s1c1
Sequence:CCGGCACTGTCGAATGAGGAACGAACTCGAGTTCGTTCCTCATTCGACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012479
VALIDATED
YWHAG MISSION shRNA Lentiviral Transduction Particles
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012479.3-423s21c1
Sequence:CCGGAGACATCTGCAGACGGCAATGCTCGAGCATTGCCGTCTGCAGATGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012479.3-338s21c1
Sequence:CCGGGAACGAAACCTTCTGTCTGTGCTCGAGCACAGACAGAAGGTTTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012479.3-310s21c1
Sequence:CCGGAGAGCTGAATGAGCCACTGTCCTCGAGGACAGTGGCTCATTCAGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422138    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012479.3-1419s21c1
Sequence:CCGGAGACATGGAACAGTGTAAATCCTCGAGGATTTACACTGTTCCATGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012479.3-451s21c1
Sequence:CCGGGATTGAGATGGTCCGTGCGTACTCGAGTACGCACGGACCATCTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012479.3-685s21c1
Sequence:CCGGAGCCCACGAGATCAGCAAAGACTCGAGTCTTTGCTGATCTCGTGGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012479.3-466s21c1
Sequence:CCGGTGCGTACCGGGAGAAGATAGACTCGAGTCTATCTTCTCCCGGTACGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012479.3-547s21c1
Sequence:CCGGGAATTGCAGCGAGACCCAGTACTCGAGTACTGGGTCTCGCTGCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426568    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012479.3-1218s21c1
Sequence:CCGGGGAGCTGTCTGTCTCTAATTTCTCGAGAAATTAGAGACAGACAGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078158    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012479.2-2158s1c1
Sequence:CCGGCCCAAGTAATTGTAGGAAGATCTCGAGATCTTCCTACAATTACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012479.2-497s1c1
Sequence:CCGGCCTGCTGGATAACTACCTGATCTCGAGATCAGGTAGTTATCCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012479.2-408s1c1
Sequence:CCGGGACGGCAATGAGAAGAAGATTCTCGAGAATCTTCTTCTCATTGCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012479.2-719s1c1
Sequence:CCGGTCTTAACTACTCCGTCTTCTACTCGAGTAGAAGACGGAGTAGTTAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012479.2-298s1c1
Sequence:CCGGCACTGTCGAATGAGGAACGAACTCGAGTTCGTTCCTCATTCGACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018871
VALIDATED
YWHAG MISSION shRNA Bacterial Glycerol Stock
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000337504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018871.3-330s21c1
Sequence:CCGGTGAACGAACCACTGTCCAATGCTCGAGCATTGGACAGTGGTTCGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337502    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018871.3-1105s21c1
Sequence:CCGGCCTGTCTTTGATTGCCTCTTTCTCGAGAAAGAGGCAATCAAAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018871.3-864s21c1
Sequence:CCGGTGAACGAGGACTCCTACAAGGCTCGAGCCTTGTAGGAGTCCTCGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018871.3-756s21c1
Sequence:CCGGTGGCGCTCAACTACTCGGTTTCTCGAGAAACCGAGTAGTTGAGCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018871.3-454s21c1
Sequence:CCGGCAACGAGAAGAAGATCGAGATCTCGAGATCTCGATCTTCTTCTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112165    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018871.2-987s1c1
Sequence:CCGGCCTGTCTTTGATTGCCTCTTTCTCGAGAAAGAGGCAATCAAAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018871.2-212s1c1
Sequence:CCGGCTGAACGAACCACTGTCCAATCTCGAGATTGGACAGTGGTTCGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018871.2-550s1c1
Sequence:CCGGCGTGGTGGAGTCGTCTGAGAACTCGAGTTCTCAGACGACTCCACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018871.2-760s1c1
Sequence:CCGGCTACAAGGACTCCACTCTGATCTCGAGATCAGAGTGGAGTCCTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018871.2-337s1c1
Sequence:CCGGCAACGAGAAGAAGATCGAGATCTCGAGATCTCGATCTTCTTCTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018871
VALIDATED
YWHAG MISSION shRNA shRNA Plasmid DNA
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000337504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018871.3-330s21c1
Sequence:CCGGTGAACGAACCACTGTCCAATGCTCGAGCATTGGACAGTGGTTCGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337502    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018871.3-1105s21c1
Sequence:CCGGCCTGTCTTTGATTGCCTCTTTCTCGAGAAAGAGGCAATCAAAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018871.3-864s21c1
Sequence:CCGGTGAACGAGGACTCCTACAAGGCTCGAGCCTTGTAGGAGTCCTCGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018871.3-756s21c1
Sequence:CCGGTGGCGCTCAACTACTCGGTTTCTCGAGAAACCGAGTAGTTGAGCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018871.3-454s21c1
Sequence:CCGGCAACGAGAAGAAGATCGAGATCTCGAGATCTCGATCTTCTTCTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112165    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018871.2-987s1c1
Sequence:CCGGCCTGTCTTTGATTGCCTCTTTCTCGAGAAAGAGGCAATCAAAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018871.2-212s1c1
Sequence:CCGGCTGAACGAACCACTGTCCAATCTCGAGATTGGACAGTGGTTCGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018871.2-550s1c1
Sequence:CCGGCGTGGTGGAGTCGTCTGAGAACTCGAGTTCTCAGACGACTCCACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018871.2-760s1c1
Sequence:CCGGCTACAAGGACTCCACTCTGATCTCGAGATCAGAGTGGAGTCCTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018871.2-337s1c1
Sequence:CCGGCAACGAGAAGAAGATCGAGATCTCGAGATCTCGATCTTCTTCTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018871
VALIDATED
YWHAG MISSION shRNA Lentiviral Transduction Particles
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000337504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018871.3-330s21c1
Sequence:CCGGTGAACGAACCACTGTCCAATGCTCGAGCATTGGACAGTGGTTCGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337502    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018871.3-1105s21c1
Sequence:CCGGCCTGTCTTTGATTGCCTCTTTCTCGAGAAAGAGGCAATCAAAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018871.3-864s21c1
Sequence:CCGGTGAACGAGGACTCCTACAAGGCTCGAGCCTTGTAGGAGTCCTCGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018871.3-756s21c1
Sequence:CCGGTGGCGCTCAACTACTCGGTTTCTCGAGAAACCGAGTAGTTGAGCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018871.3-454s21c1
Sequence:CCGGCAACGAGAAGAAGATCGAGATCTCGAGATCTCGATCTTCTTCTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112165    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018871.2-987s1c1
Sequence:CCGGCCTGTCTTTGATTGCCTCTTTCTCGAGAAAGAGGCAATCAAAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018871.2-212s1c1
Sequence:CCGGCTGAACGAACCACTGTCCAATCTCGAGATTGGACAGTGGTTCGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018871.2-550s1c1
Sequence:CCGGCGTGGTGGAGTCGTCTGAGAACTCGAGTTCTCAGACGACTCCACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018871.2-760s1c1
Sequence:CCGGCTACAAGGACTCCACTCTGATCTCGAGATCAGAGTGGAGTCCTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018871.2-337s1c1
Sequence:CCGGCAACGAGAAGAAGATCGAGATCTCGAGATCTCGATCTTCTTCTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks