EMAIL THIS PAGE TO A FRIEND

YWHAH

tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide

Synonyms: YWHA1
UniProtKB ID: Q04917
Gene ID:
Human(7533) Summary: This gene product belongs to the 14-3-3 family of proteins which mediate signal transduction by binding to phosphoserine-containing proteins. This highly conserved protein family is found in both plants and mammals, and this protein is 99% identical to the mouse, rat and bovine orthologs. This gene contains a 7 bp repeat sequence in its 5' UTR, and changes in the number of this repeat have been associated with early-onset schizophrenia and psychotic bipolar disorder. [provided by RefSeq, Jun 2009]
Mouse(22629) tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide
Rat(25576) tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide
Zebrafish(406443) tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide
domestic cat(101099908) tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide
dog(100687866) tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide
chicken(416955) tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide
naked mole-rat(101709704) tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide
Domestic Rabbit(100328734) tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide
domestic guinea pig(100728374) tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide
cow(282126) tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide
Gene Class: Apoptosis
115 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003405 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003405 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003405 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011738 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011738 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011738 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003405 Rosetta Predictions human pricing
NM_013052 Rosetta Predictions rat pricing
NM_011738 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003405 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050114 predicted 1066
2 SASI_Hs01_00050115 predicted 865
3 SASI_Hs02_00335597 predicted 1038
4 SASI_Hs01_00050116 predicted 575
5 SASI_Hs01_00050118 predicted 565
6 SASI_Hs01_00050119 predicted 1028
7 SASI_Hs01_00050120 predicted 463
8 SASI_Hs01_00050121 predicted 1046
9 SASI_Hs01_00050122 predicted 614
10 SASI_Hs02_00335598 predicted 1052
11 SASI_Hs01_00050117 predicted 1031
12 SASI_Hs01_00050123 predicted 313
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013052 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049264 predicted 1191
2 SASI_Rn01_00049265 predicted 350
3 SASI_Rn01_00049266 predicted 1170
4 SASI_Rn02_00260789 predicted 1135
5 SASI_Rn01_00049267 predicted 1171
6 SASI_Rn01_00049269 predicted 798
7 SASI_Rn01_00049270 predicted 1180
8 SASI_Rn01_00049271 predicted 957
9 SASI_Rn01_00049272 predicted 764
10 SASI_Rn01_00049273 predicted 982
11 SASI_Rn01_00049268 predicted 774
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011738 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00124409 predicted 303
2 SASI_Mm01_00124410 predicted 1035
3 SASI_Mm02_00321311 predicted 845
4 SASI_Mm01_00124412 predicted 874
5 SASI_Mm01_00124413 predicted 1035
6 SASI_Mm01_00124414 predicted 832
7 SASI_Mm01_00124415 predicted 1054
8 SASI_Mm01_00124416 predicted 1065
9 SASI_Mm01_00124417 predicted 311
10 SASI_Mm01_00124418 predicted 705
11 SASI_Mm01_00124411 predicted 400
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003405
VALIDATED
YWHAH MISSION shRNA Bacterial Glycerol Stock
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003405.2-820s1c1
Sequence:CCGGTGGACACACTAAACGAGGATTCTCGAGAATCCTCGTTTAGTGTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003405.2-304s1c1
Sequence:CCGGCTCTCTCCAATGAAGATCGAACTCGAGTTCGATCTTCATTGGAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003405.2-656s1c1
Sequence:CCGGCTACAAGGAAGCCTTTGAAATCTCGAGATTTCAAAGGCTTCCTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003405.2-527s1c1
Sequence:CCGGGAACTGCAATGATTTCCAGTACTCGAGTACTGGAAATCATTGCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003405.3-624s21c1
Sequence:CCGGGTGATTACTACCGCTACTTAGCTCGAGCTAAGTAGCGGTAGTAATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003405.3-944s21c1
Sequence:CCGGAGCGACCAGCAGGATGAAGAACTCGAGTTCTTCATCCTGCTGGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003405.3-471s21c1
Sequence:CCGGAGAAATTGGAGAAAGTTAAAGCTCGAGCTTTAACTTTCTCCAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369692    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003405.3-1341s21c1
Sequence:CCGGAGCTGATAGTGTTTCGTTAAGCTCGAGCTTAACGAAACACTATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003405.3-520s21c1
Sequence:CCGGGGAGACAGTTTGCAATGATGTCTCGAGACATCATTGCAAACTGTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003405.2-779s1c2
Sequence:CCGGCCTCTTAGCCAAACAAGCCTTCTCGAGAAGGCTTGTTTGGCTAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003405.3-573s21c1
Sequence:CCGGACTGCAATGATTTCCAGTATGCTCGAGCATACTGGAAATCATTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364820    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003405.3-1234s21c1
Sequence:CCGGTACTATGCCTGTTGATCTATGCTCGAGCATAGATCAACAGGCATAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003405
VALIDATED
YWHAH MISSION shRNA shRNA Plasmid DNA
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003405.2-820s1c1
Sequence:CCGGTGGACACACTAAACGAGGATTCTCGAGAATCCTCGTTTAGTGTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003405.2-304s1c1
Sequence:CCGGCTCTCTCCAATGAAGATCGAACTCGAGTTCGATCTTCATTGGAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003405.2-656s1c1
Sequence:CCGGCTACAAGGAAGCCTTTGAAATCTCGAGATTTCAAAGGCTTCCTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003405.2-527s1c1
Sequence:CCGGGAACTGCAATGATTTCCAGTACTCGAGTACTGGAAATCATTGCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003405.3-624s21c1
Sequence:CCGGGTGATTACTACCGCTACTTAGCTCGAGCTAAGTAGCGGTAGTAATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003405.3-944s21c1
Sequence:CCGGAGCGACCAGCAGGATGAAGAACTCGAGTTCTTCATCCTGCTGGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003405.3-471s21c1
Sequence:CCGGAGAAATTGGAGAAAGTTAAAGCTCGAGCTTTAACTTTCTCCAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369692    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003405.3-1341s21c1
Sequence:CCGGAGCTGATAGTGTTTCGTTAAGCTCGAGCTTAACGAAACACTATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003405.3-520s21c1
Sequence:CCGGGGAGACAGTTTGCAATGATGTCTCGAGACATCATTGCAAACTGTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003405.2-779s1c2
Sequence:CCGGCCTCTTAGCCAAACAAGCCTTCTCGAGAAGGCTTGTTTGGCTAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003405.3-573s21c1
Sequence:CCGGACTGCAATGATTTCCAGTATGCTCGAGCATACTGGAAATCATTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364820    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003405.3-1234s21c1
Sequence:CCGGTACTATGCCTGTTGATCTATGCTCGAGCATAGATCAACAGGCATAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003405
VALIDATED
YWHAH MISSION shRNA Lentiviral Transduction Particles
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003405.2-820s1c1
Sequence:CCGGTGGACACACTAAACGAGGATTCTCGAGAATCCTCGTTTAGTGTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003405.2-304s1c1
Sequence:CCGGCTCTCTCCAATGAAGATCGAACTCGAGTTCGATCTTCATTGGAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003405.2-656s1c1
Sequence:CCGGCTACAAGGAAGCCTTTGAAATCTCGAGATTTCAAAGGCTTCCTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003405.2-527s1c1
Sequence:CCGGGAACTGCAATGATTTCCAGTACTCGAGTACTGGAAATCATTGCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003405.3-624s21c1
Sequence:CCGGGTGATTACTACCGCTACTTAGCTCGAGCTAAGTAGCGGTAGTAATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003405.3-944s21c1
Sequence:CCGGAGCGACCAGCAGGATGAAGAACTCGAGTTCTTCATCCTGCTGGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003405.3-471s21c1
Sequence:CCGGAGAAATTGGAGAAAGTTAAAGCTCGAGCTTTAACTTTCTCCAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369692    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003405.3-1341s21c1
Sequence:CCGGAGCTGATAGTGTTTCGTTAAGCTCGAGCTTAACGAAACACTATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003405.3-520s21c1
Sequence:CCGGGGAGACAGTTTGCAATGATGTCTCGAGACATCATTGCAAACTGTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003405.2-779s1c2
Sequence:CCGGCCTCTTAGCCAAACAAGCCTTCTCGAGAAGGCTTGTTTGGCTAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003405.3-573s21c1
Sequence:CCGGACTGCAATGATTTCCAGTATGCTCGAGCATACTGGAAATCATTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364820    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003405.3-1234s21c1
Sequence:CCGGTACTATGCCTGTTGATCTATGCTCGAGCATAGATCAACAGGCATAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011738
VALIDATED
YWHAH MISSION shRNA Bacterial Glycerol Stock
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011738.1-766s1c1
Sequence:CCGGGCCAAACAAGCCTTCGATGATCTCGAGATCATCGAAGGCTTGTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011738.1-273s1c1
Sequence:CCGGGCTGAATGAACCACTATCTAACTCGAGTTAGATAGTGGTTCATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011738.1-486s1c1
Sequence:CCGGGCTTGACAAGTTCCTTATCAACTCGAGTTGATAAGGAACTTGTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011738.1-345s1c1
Sequence:CCGGGCGATCTTCTTGGAGGGTTATCTCGAGATAACCCTCCAAGAAGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076388    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011738.1-1328s1c1
Sequence:CCGGCCTCCCTTCAGCTAATGGAAACTCGAGTTTCCATTAGCTGAAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011738.2-348s21c1
Sequence:CCGGGCTGAATGAACCACTATCTAACTCGAGTTAGATAGTGGTTCATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011738.2-841s21c1
Sequence:CCGGGCCAAACAAGCCTTCGATGATCTCGAGATCATCGAAGGCTTGTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323969    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011738.2-1406s21c1
Sequence:CCGGCCTCCCTTCAGCTAATGGAAACTCGAGTTTCCATTAGCTGAAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011738.2-420s21c1
Sequence:CCGGGCGATCTTCTTGGAGGGTTATCTCGAGATAACCCTCCAAGAAGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011738.2-561s21c1
Sequence:CCGGGCTTGACAAGTTCCTTATCAACTCGAGTTGATAAGGAACTTGTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011738
VALIDATED
YWHAH MISSION shRNA shRNA Plasmid DNA
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011738.1-766s1c1
Sequence:CCGGGCCAAACAAGCCTTCGATGATCTCGAGATCATCGAAGGCTTGTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011738.1-273s1c1
Sequence:CCGGGCTGAATGAACCACTATCTAACTCGAGTTAGATAGTGGTTCATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011738.1-486s1c1
Sequence:CCGGGCTTGACAAGTTCCTTATCAACTCGAGTTGATAAGGAACTTGTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011738.1-345s1c1
Sequence:CCGGGCGATCTTCTTGGAGGGTTATCTCGAGATAACCCTCCAAGAAGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076388    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011738.1-1328s1c1
Sequence:CCGGCCTCCCTTCAGCTAATGGAAACTCGAGTTTCCATTAGCTGAAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011738.2-348s21c1
Sequence:CCGGGCTGAATGAACCACTATCTAACTCGAGTTAGATAGTGGTTCATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011738.2-841s21c1
Sequence:CCGGGCCAAACAAGCCTTCGATGATCTCGAGATCATCGAAGGCTTGTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323969    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011738.2-1406s21c1
Sequence:CCGGCCTCCCTTCAGCTAATGGAAACTCGAGTTTCCATTAGCTGAAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011738.2-420s21c1
Sequence:CCGGGCGATCTTCTTGGAGGGTTATCTCGAGATAACCCTCCAAGAAGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011738.2-561s21c1
Sequence:CCGGGCTTGACAAGTTCCTTATCAACTCGAGTTGATAAGGAACTTGTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011738
VALIDATED
YWHAH MISSION shRNA Lentiviral Transduction Particles
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011738.1-766s1c1
Sequence:CCGGGCCAAACAAGCCTTCGATGATCTCGAGATCATCGAAGGCTTGTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011738.1-273s1c1
Sequence:CCGGGCTGAATGAACCACTATCTAACTCGAGTTAGATAGTGGTTCATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011738.1-486s1c1
Sequence:CCGGGCTTGACAAGTTCCTTATCAACTCGAGTTGATAAGGAACTTGTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011738.1-345s1c1
Sequence:CCGGGCGATCTTCTTGGAGGGTTATCTCGAGATAACCCTCCAAGAAGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076388    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011738.1-1328s1c1
Sequence:CCGGCCTCCCTTCAGCTAATGGAAACTCGAGTTTCCATTAGCTGAAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011738.2-348s21c1
Sequence:CCGGGCTGAATGAACCACTATCTAACTCGAGTTAGATAGTGGTTCATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011738.2-841s21c1
Sequence:CCGGGCCAAACAAGCCTTCGATGATCTCGAGATCATCGAAGGCTTGTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323969    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011738.2-1406s21c1
Sequence:CCGGCCTCCCTTCAGCTAATGGAAACTCGAGTTTCCATTAGCTGAAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011738.2-420s21c1
Sequence:CCGGGCGATCTTCTTGGAGGGTTATCTCGAGATAACCCTCCAAGAAGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011738.2-561s21c1
Sequence:CCGGGCTTGACAAGTTCCTTATCAACTCGAGTTGATAAGGAACTTGTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks