EMAIL THIS PAGE TO A FRIEND

YWHAQ

tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide

Synonyms: 14-3-3 1C5 HS1
UniProtKB ID: P27348, D6W4Z5, Q567U5, Q5TZU8, Q9UP48
Gene ID:
Human(10971) Summary: This gene product belongs to the 14-3-3 family of proteins which mediate signal transduction by binding to phosphoserine-containing proteins. This highly conserved protein family is found in both plants and mammals, and this protein is 99% identical to the mouse and rat orthologs. This gene is upregulated in patients with amyotrophic lateral sclerosis. It contains in its 5' UTR a 6 bp tandem repeat sequence which is polymorphic, however, there is no correlation between the repeat number and the disease. [provided by RefSeq, Jul 2008]
Mouse(22630) tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide
Rat(25577) tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide
cow(768311) tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide
sheep(101117574) tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide
domestic guinea pig(100733198) tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide
Domestic Rabbit(100008930) tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide
naked mole-rat(101720117) tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide
chicken(421932) tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide
domestic cat(101088481) tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide
dog(607060) tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide
138 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2500002 Anti-14-3-3 TAU/YWHAQ antibody produced in goat affinity isolated antibody, buffered aqueous solution rat, mouse, canine, human
ELISA, western blot pricing
SAB4500186 Anti-14-3-3 THET antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
SAB4502213 Anti-14-3-3 THET, C-Terminal antibody produced in rabbit affinity isolated antibody human, mouse
immunofluorescence, western blot pricing
AV02062 Anti-YWHAQ antibody produced in rabbit affinity isolated antibody canine, zebrafish, bovine, guinea pig, rat, mouse, human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006826 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006826 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006826 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011739 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011739 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011739 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006826 Rosetta Predictions human pricing
NM_013053 Rosetta Predictions rat pricing
NM_011739 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006826 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196250 predicted 856
2 SASI_Hs01_00196251 predicted 480
3 SASI_Hs01_00196252 predicted 553
4 SASI_Hs01_00196253 predicted 556
5 SASI_Hs01_00196255 predicted 594
6 SASI_Hs02_00342382 predicted 583
7 SASI_Hs01_00196254 predicted 404
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013053 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00118435 predicted 376
2 SASI_Rn01_00118436 predicted 688
3 SASI_Rn01_00118438 predicted 744
4 SASI_Rn01_00118439 predicted 374
5 SASI_Rn01_00118440 predicted 296
6 SASI_Rn01_00118441 predicted 750
7 SASI_Rn02_00260790 predicted 459
8 SASI_Rn02_00260791 predicted 524
9 SASI_Rn01_00118434 predicted 447
10 SASI_Rn02_00260792 predicted 548
11 SASI_Rn01_00118437 predicted 901
12 SASI_Rn01_00118442 predicted 885
13 SASI_Rn01_00118443 predicted 898
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011739 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00321312 predicted 783
2 SASI_Mm02_00321313 predicted 708
3 SASI_Mm02_00321314 predicted 1318
4 SASI_Mm02_00321315 predicted 1317
5 SASI_Mm02_00321316 predicted 1158
6 SASI_Mm02_00321317 predicted 1181
7 SASI_Mm02_00321318 predicted 1327
8 SASI_Mm02_00321319 predicted 664
9 SASI_Mm02_00321320 predicted 1181
10 SASI_Mm02_00321321 predicted 529
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006826
VALIDATED
YWHAQ MISSION shRNA Bacterial Glycerol Stock
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006826.2-515s21c1
Sequence:CCGGTGCGTGTGGTGATGATCGAAACTCGAGTTTCGATCATCACCACACGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006826.2-379s21c1
Sequence:CCGGAGTCCGAGCTGAGATCCATCTCTCGAGAGATGGATCTCAGCTCGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006826.2-433s21c1
Sequence:CCGGTAATAGCCAATGCAACTAATCCTCGAGGATTAGTTGCATTGGCTATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006826.2-402s21c1
Sequence:CCGGACCACGGTGCTGGAATTGTTGCTCGAGCAACAATTCCAGCACCGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006826.2-559s21c1
Sequence:CCGGGAGCTTACCAAGAGGCATTTGCTCGAGCAAATGCCTCTTGGTAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078168    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006826.2-1826s1c1
Sequence:CCGGGCCCTATGTAACAGCAGAGTACTCGAGTACTCTGCTGTTACATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006826.2-774s1c1
Sequence:CCGGCAGTTGCTTAGAGACAACCTACTCGAGTAGGTTGTCTCTAAGCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006826.2-779s1c1
Sequence:CCGGGCTTAGAGACAACCTAACACTCTCGAGAGTGTTAGGTTGTCTCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006826.2-537s1c1
Sequence:CCGGCAAACGATAGATAATTCCCAACTCGAGTTGGGAATTATCTATCGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006826
VALIDATED
YWHAQ MISSION shRNA shRNA Plasmid DNA
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006826.2-515s21c1
Sequence:CCGGTGCGTGTGGTGATGATCGAAACTCGAGTTTCGATCATCACCACACGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006826.2-379s21c1
Sequence:CCGGAGTCCGAGCTGAGATCCATCTCTCGAGAGATGGATCTCAGCTCGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006826.2-433s21c1
Sequence:CCGGTAATAGCCAATGCAACTAATCCTCGAGGATTAGTTGCATTGGCTATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006826.2-402s21c1
Sequence:CCGGACCACGGTGCTGGAATTGTTGCTCGAGCAACAATTCCAGCACCGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006826.2-559s21c1
Sequence:CCGGGAGCTTACCAAGAGGCATTTGCTCGAGCAAATGCCTCTTGGTAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078168    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006826.2-1826s1c1
Sequence:CCGGGCCCTATGTAACAGCAGAGTACTCGAGTACTCTGCTGTTACATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006826.2-774s1c1
Sequence:CCGGCAGTTGCTTAGAGACAACCTACTCGAGTAGGTTGTCTCTAAGCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006826.2-779s1c1
Sequence:CCGGGCTTAGAGACAACCTAACACTCTCGAGAGTGTTAGGTTGTCTCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006826.2-537s1c1
Sequence:CCGGCAAACGATAGATAATTCCCAACTCGAGTTGGGAATTATCTATCGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006826
VALIDATED
YWHAQ MISSION shRNA Lentiviral Transduction Particles
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006826.2-515s21c1
Sequence:CCGGTGCGTGTGGTGATGATCGAAACTCGAGTTTCGATCATCACCACACGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006826.2-379s21c1
Sequence:CCGGAGTCCGAGCTGAGATCCATCTCTCGAGAGATGGATCTCAGCTCGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006826.2-433s21c1
Sequence:CCGGTAATAGCCAATGCAACTAATCCTCGAGGATTAGTTGCATTGGCTATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006826.2-402s21c1
Sequence:CCGGACCACGGTGCTGGAATTGTTGCTCGAGCAACAATTCCAGCACCGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006826.2-559s21c1
Sequence:CCGGGAGCTTACCAAGAGGCATTTGCTCGAGCAAATGCCTCTTGGTAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078168    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006826.2-1826s1c1
Sequence:CCGGGCCCTATGTAACAGCAGAGTACTCGAGTACTCTGCTGTTACATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006826.2-774s1c1
Sequence:CCGGCAGTTGCTTAGAGACAACCTACTCGAGTAGGTTGTCTCTAAGCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006826.2-779s1c1
Sequence:CCGGGCTTAGAGACAACCTAACACTCTCGAGAGTGTTAGGTTGTCTCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006826.2-537s1c1
Sequence:CCGGCAAACGATAGATAATTCCCAACTCGAGTTGGGAATTATCTATCGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011739
VALIDATED
YWHAQ MISSION shRNA Bacterial Glycerol Stock
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000312370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011739.3-636s21c1
Sequence:CCGGCCTGGAATTGTTGGATAAGTACTCGAGTACTTATCCAACAATTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011739.3-528s21c1
Sequence:CCGGCATCTCGAGCATTGAGCAGAACTCGAGTTCTGCTCAATGCTCGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011739.3-679s21c1
Sequence:CCGGCCAGAGAGTAAGGTCTTCTATCTCGAGATAGAAGACCTTACTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313483    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011739.3-1409s21c1
Sequence:CCGGTTTGTATTACTGCGAAGATATCTCGAGATATCTTCGCAGTAATACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011739.3-962s21c1
Sequence:CCGGTGAACGAAGACTCCTACAAAGCTCGAGCTTTGTAGGAGTCTTCGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011739.1-220s1c1
Sequence:CCGGCATCTCGAGCATTGAGCAGAACTCGAGTTCTGCTCAATGCTCGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011739.1-272s1c1
Sequence:CCGGATCAAGGACTATCGGGAGAAACTCGAGTTTCTCCCGATAGTCCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011739.1-328s1c1
Sequence:CCGGCCTGGAATTGTTGGATAAGTACTCGAGTACTTATCCAACAATTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011739.1-371s1c1
Sequence:CCGGCCAGAGAGTAAGGTCTTCTATCTCGAGATAGAAGACCTTACTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011739
VALIDATED
YWHAQ MISSION shRNA shRNA Plasmid DNA
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000312370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011739.3-636s21c1
Sequence:CCGGCCTGGAATTGTTGGATAAGTACTCGAGTACTTATCCAACAATTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011739.3-528s21c1
Sequence:CCGGCATCTCGAGCATTGAGCAGAACTCGAGTTCTGCTCAATGCTCGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011739.3-679s21c1
Sequence:CCGGCCAGAGAGTAAGGTCTTCTATCTCGAGATAGAAGACCTTACTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313483    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011739.3-1409s21c1
Sequence:CCGGTTTGTATTACTGCGAAGATATCTCGAGATATCTTCGCAGTAATACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011739.3-962s21c1
Sequence:CCGGTGAACGAAGACTCCTACAAAGCTCGAGCTTTGTAGGAGTCTTCGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011739.1-220s1c1
Sequence:CCGGCATCTCGAGCATTGAGCAGAACTCGAGTTCTGCTCAATGCTCGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011739.1-272s1c1
Sequence:CCGGATCAAGGACTATCGGGAGAAACTCGAGTTTCTCCCGATAGTCCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011739.1-328s1c1
Sequence:CCGGCCTGGAATTGTTGGATAAGTACTCGAGTACTTATCCAACAATTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011739.1-371s1c1
Sequence:CCGGCCAGAGAGTAAGGTCTTCTATCTCGAGATAGAAGACCTTACTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011739
VALIDATED
YWHAQ MISSION shRNA Lentiviral Transduction Particles
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000312370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011739.3-636s21c1
Sequence:CCGGCCTGGAATTGTTGGATAAGTACTCGAGTACTTATCCAACAATTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011739.3-528s21c1
Sequence:CCGGCATCTCGAGCATTGAGCAGAACTCGAGTTCTGCTCAATGCTCGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011739.3-679s21c1
Sequence:CCGGCCAGAGAGTAAGGTCTTCTATCTCGAGATAGAAGACCTTACTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313483    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011739.3-1409s21c1
Sequence:CCGGTTTGTATTACTGCGAAGATATCTCGAGATATCTTCGCAGTAATACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011739.3-962s21c1
Sequence:CCGGTGAACGAAGACTCCTACAAAGCTCGAGCTTTGTAGGAGTCTTCGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011739.1-220s1c1
Sequence:CCGGCATCTCGAGCATTGAGCAGAACTCGAGTTCTGCTCAATGCTCGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011739.1-272s1c1
Sequence:CCGGATCAAGGACTATCGGGAGAAACTCGAGTTTCTCCCGATAGTCCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011739.1-328s1c1
Sequence:CCGGCCTGGAATTGTTGGATAAGTACTCGAGTACTTATCCAACAATTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011739.1-371s1c1
Sequence:CCGGCCAGAGAGTAAGGTCTTCTATCTCGAGATAGAAGACCTTACTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks