EMAIL THIS PAGE TO A FRIEND

YWHAZ

tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide

Synonyms: 14-3-3-zeta KCIP-1 YWHAD
Gene ID:
Human(7534) Summary: This gene product belongs to the 14-3-3 family of proteins which mediate signal transduction by binding to phosphoserine-containing proteins. This highly conserved protein family is found in both plants and mammals, and this protein is 99% identical to the mouse, rat and sheep orthologs. The encoded protein interacts with IRS1 protein, suggesting a role in regulating insulin sensitivity. Several transcript variants that differ in the 5' UTR but that encode the same protein have been identified for this gene. [provided by RefSeq, Oct 2008]
Mouse(22631) tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide
Rat(25578) tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide
Zebrafish(336610) tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide
domestic cat(100127113) tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide
dog(475864) tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide
chicken(425619) tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide
naked mole-rat(101721954) tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide
domestic guinea pig(100727182) tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide
cow(287022) tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide
sheep(780452) tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide
221 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4503103 Anti-14-3-3 ζ antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunohistochemistry, western blot pricing
SAB4503105 Anti-14-3-3 ζ antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
SAB4503104 Anti-14-3-3 ζ, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunohistochemistry, western blot pricing
SAB4504572 Anti-phospho-14-3-3 β/ζ (pSer184/186) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
SAB4503752 Anti-phospho-14-3-3 ζ (pSer58) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4504070 Anti-phospho-14-3-3 ζ/δ (pThr232) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4301452 Anti-phospho-14-3-3 ζ/δ (pThr232) antibody produced in rabbit affinity isolated antibody human, rat, mouse
western blot pricing
SAB4300147 Anti-phospho-YWHAZ (pSer58) antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300449 Anti-YWHAZ (Ab-58) antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunohistochemistry, western blot pricing
AV48046 Anti-YWHAZ antibody produced in rabbit IgG fraction of antiserum , mouse, human, bovine, pig, rat, guinea pig, horse, canine, sheep, rabbit
western blot pricing
SAB2102737 Anti-YWHAZ antibody produced in rabbit affinity isolated antibody bovine, zebrafish, human, mouse, sheep, horse, canine, rat, guinea pig, rabbit
western blot pricing
SAB1402395 Monoclonal Anti-YWHAZ antibody produced in mouse clone 1B3, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011740 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011740 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011740 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003406 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003406 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003406 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003406 Rosetta Predictions human pricing
NM_145690 Rosetta Predictions human pricing
NM_013011 Rosetta Predictions rat pricing
NM_011740 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003406 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00210834 predicted 719
2 SASI_Hs01_00210836 predicted 346
3 SASI_Hs01_00210837 predicted 919
4 SASI_Hs01_00210839 predicted 357
5 SASI_Hs01_00210840 predicted 509
6 SASI_Hs02_00335599 predicted 916
7 SASI_Hs02_00335600 predicted 694
8 SASI_Hs02_00335601 predicted 348
9 SASI_Hs02_00335602 predicted 448
10 SASI_Hs01_00210833 predicted 1096
11 SASI_Hs01_00210835 predicted 882
12 SASI_Hs01_00210838 predicted 923
13 SASI_Hs01_00210841 predicted 1082
14 SASI_Hs01_00210842 predicted 993
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145690 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081690 predicted 766
2 SASI_Hs01_00081692 predicted 386
3 SASI_Hs01_00081693 predicted 957
4 SASI_Hs01_00081695 predicted 407
5 SASI_Hs01_00081696 predicted 556
6 SASI_Hs02_00365293 predicted 957
7 SASI_Hs02_00365294 predicted 732
8 SASI_Hs02_00365295 predicted 386
9 SASI_Hs02_00365296 predicted 486
10 SASI_Hs01_00081689 predicted 1137
11 SASI_Hs01_00081691 predicted 917
12 SASI_Hs01_00081694 predicted 965
13 SASI_Hs01_00081697 predicted 1122
14 SASI_Hs01_00081698 predicted 1032
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013011 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044848 predicted 304
2 SASI_Rn01_00044850 predicted 893
3 SASI_Rn01_00044851 predicted 399
4 SASI_Rn01_00044852 predicted 392
5 SASI_Rn02_00260666 predicted 903
6 SASI_Rn02_00260667 predicted 906
7 SASI_Rn01_00044853 predicted 654
8 SASI_Rn02_00260668 predicted 898
9 SASI_Rn02_00260669 predicted 1049
10 SASI_Rn01_00044854 predicted 885
11 SASI_Rn01_00044849 predicted 492
12 SASI_Rn01_00044855 predicted 691
13 SASI_Rn01_00044856 predicted 706
14 SASI_Rn01_00044857 predicted 995
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011740 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00181457 predicted 552
2 SASI_Mm02_00321322 predicted 889
3 SASI_Mm01_00181459 predicted 1079
4 SASI_Mm01_00181460 predicted 1141
5 SASI_Mm01_00181461 predicted 961
6 SASI_Mm01_00181462 predicted 949
7 SASI_Mm01_00181463 predicted 589
8 SASI_Mm01_00181464 predicted 901
9 SASI_Mm01_00181465 predicted 352
10 SASI_Mm01_00181466 predicted 1134
11 SASI_Mm01_00181458 predicted 821
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011740
VALIDATED
YWHAZ MISSION shRNA Bacterial Glycerol Stock
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011740.2-904s1c1
Sequence:CCGGCCATTGCTGAACTTGATACATCTCGAGATGTATCAAGTTCAGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011740.2-491s1c1
Sequence:CCGGCGTCTCAAGTATTGAGCAGAACTCGAGTTCTGCTCAATACTTGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011740.2-638s1c1
Sequence:CCGGGCAACCAGAAAGCAAAGTCTTCTCGAGAAGACTTTGCTTTCTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011740.2-413s1c1
Sequence:CCGGGCTGTCGAATGAGGAGAGAAACTCGAGTTTCTCTCCTCATTCGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011740.2-589s1c1
Sequence:CCGGGCAACGATGTACTGTCTCTTTCTCGAGAAAGAGACAGTACATCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011740.2-491s21c1
Sequence:CCGGCGTCTCAAGTATTGAGCAGAACTCGAGTTCTGCTCAATACTTGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011740.2-904s21c1
Sequence:CCGGCCATTGCTGAACTTGATACATCTCGAGATGTATCAAGTTCAGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011740.2-413s21c1
Sequence:CCGGGCTGTCGAATGAGGAGAGAAACTCGAGTTTCTCTCCTCATTCGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011740.2-638s21c1
Sequence:CCGGGCAACCAGAAAGCAAAGTCTTCTCGAGAAGACTTTGCTTTCTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011740.2-589s21c1
Sequence:CCGGGCAACGATGTACTGTCTCTTTCTCGAGAAAGAGACAGTACATCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011740
VALIDATED
YWHAZ MISSION shRNA shRNA Plasmid DNA
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011740.2-904s1c1
Sequence:CCGGCCATTGCTGAACTTGATACATCTCGAGATGTATCAAGTTCAGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011740.2-491s1c1
Sequence:CCGGCGTCTCAAGTATTGAGCAGAACTCGAGTTCTGCTCAATACTTGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011740.2-638s1c1
Sequence:CCGGGCAACCAGAAAGCAAAGTCTTCTCGAGAAGACTTTGCTTTCTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011740.2-413s1c1
Sequence:CCGGGCTGTCGAATGAGGAGAGAAACTCGAGTTTCTCTCCTCATTCGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011740.2-589s1c1
Sequence:CCGGGCAACGATGTACTGTCTCTTTCTCGAGAAAGAGACAGTACATCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011740.2-491s21c1
Sequence:CCGGCGTCTCAAGTATTGAGCAGAACTCGAGTTCTGCTCAATACTTGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011740.2-904s21c1
Sequence:CCGGCCATTGCTGAACTTGATACATCTCGAGATGTATCAAGTTCAGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011740.2-413s21c1
Sequence:CCGGGCTGTCGAATGAGGAGAGAAACTCGAGTTTCTCTCCTCATTCGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011740.2-638s21c1
Sequence:CCGGGCAACCAGAAAGCAAAGTCTTCTCGAGAAGACTTTGCTTTCTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011740.2-589s21c1
Sequence:CCGGGCAACGATGTACTGTCTCTTTCTCGAGAAAGAGACAGTACATCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011740
VALIDATED
YWHAZ MISSION shRNA Lentiviral Transduction Particles
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011740.2-904s1c1
Sequence:CCGGCCATTGCTGAACTTGATACATCTCGAGATGTATCAAGTTCAGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011740.2-491s1c1
Sequence:CCGGCGTCTCAAGTATTGAGCAGAACTCGAGTTCTGCTCAATACTTGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011740.2-638s1c1
Sequence:CCGGGCAACCAGAAAGCAAAGTCTTCTCGAGAAGACTTTGCTTTCTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011740.2-413s1c1
Sequence:CCGGGCTGTCGAATGAGGAGAGAAACTCGAGTTTCTCTCCTCATTCGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011740.2-589s1c1
Sequence:CCGGGCAACGATGTACTGTCTCTTTCTCGAGAAAGAGACAGTACATCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011740.2-491s21c1
Sequence:CCGGCGTCTCAAGTATTGAGCAGAACTCGAGTTCTGCTCAATACTTGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011740.2-904s21c1
Sequence:CCGGCCATTGCTGAACTTGATACATCTCGAGATGTATCAAGTTCAGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011740.2-413s21c1
Sequence:CCGGGCTGTCGAATGAGGAGAGAAACTCGAGTTTCTCTCCTCATTCGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011740.2-638s21c1
Sequence:CCGGGCAACCAGAAAGCAAAGTCTTCTCGAGAAGACTTTGCTTTCTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011740.2-589s21c1
Sequence:CCGGGCAACGATGTACTGTCTCTTTCTCGAGAAAGAGACAGTACATCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003406
VALIDATED
YWHAZ MISSION shRNA Bacterial Glycerol Stock
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_003406.2-418s1c1
Sequence:CCGGGCAGAGAGCAAAGTCTTCTATCTCGAGATAGAAGACTTTGCTCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_003406.2-606s1c1
Sequence:CCGGCTCTGTGTTCTATTATGAGATCTCGAGATCTCATAATAGAACACAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_003406.2-202s1c1
Sequence:CCGGGAGAGGAATCTTCTCTCAGTTCTCGAGAACTGAGAGAAGATTCCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_003406.2-738s1c1
Sequence:CCGGGCAATTACTGAGAGACAACTTCTCGAGAAGTTGTCTCTCAGTAATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_003406.2-319s1c1
Sequence:CCGGGCTCGAGAATACAGAGAGAAACTCGAGTTTCTCTCTGTATTCTCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003406.3-472s21c1
Sequence:CCGGGCAGAGAGCAAAGTCTTCTATCTCGAGATAGAAGACTTTGCTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003406.3-660s21c1
Sequence:CCGGCTCTGTGTTCTATTATGAGATCTCGAGATCTCATAATAGAACACAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003406.3-373s21c1
Sequence:CCGGGCTCGAGAATACAGAGAGAAACTCGAGTTTCTCTCTGTATTCTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003406.3-792s21c1
Sequence:CCGGGCAATTACTGAGAGACAACTTCTCGAGAAGTTGTCTCTCAGTAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003406
VALIDATED
YWHAZ MISSION shRNA shRNA Plasmid DNA
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_003406.2-418s1c1
Sequence:CCGGGCAGAGAGCAAAGTCTTCTATCTCGAGATAGAAGACTTTGCTCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_003406.2-606s1c1
Sequence:CCGGCTCTGTGTTCTATTATGAGATCTCGAGATCTCATAATAGAACACAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_003406.2-202s1c1
Sequence:CCGGGAGAGGAATCTTCTCTCAGTTCTCGAGAACTGAGAGAAGATTCCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_003406.2-738s1c1
Sequence:CCGGGCAATTACTGAGAGACAACTTCTCGAGAAGTTGTCTCTCAGTAATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_003406.2-319s1c1
Sequence:CCGGGCTCGAGAATACAGAGAGAAACTCGAGTTTCTCTCTGTATTCTCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003406.3-472s21c1
Sequence:CCGGGCAGAGAGCAAAGTCTTCTATCTCGAGATAGAAGACTTTGCTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003406.3-660s21c1
Sequence:CCGGCTCTGTGTTCTATTATGAGATCTCGAGATCTCATAATAGAACACAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003406.3-373s21c1
Sequence:CCGGGCTCGAGAATACAGAGAGAAACTCGAGTTTCTCTCTGTATTCTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003406.3-792s21c1
Sequence:CCGGGCAATTACTGAGAGACAACTTCTCGAGAAGTTGTCTCTCAGTAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003406
VALIDATED
YWHAZ MISSION shRNA Lentiviral Transduction Particles
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_003406.2-418s1c1
Sequence:CCGGGCAGAGAGCAAAGTCTTCTATCTCGAGATAGAAGACTTTGCTCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_003406.2-606s1c1
Sequence:CCGGCTCTGTGTTCTATTATGAGATCTCGAGATCTCATAATAGAACACAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_003406.2-202s1c1
Sequence:CCGGGAGAGGAATCTTCTCTCAGTTCTCGAGAACTGAGAGAAGATTCCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_003406.2-738s1c1
Sequence:CCGGGCAATTACTGAGAGACAACTTCTCGAGAAGTTGTCTCTCAGTAATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_003406.2-319s1c1
Sequence:CCGGGCTCGAGAATACAGAGAGAAACTCGAGTTTCTCTCTGTATTCTCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003406.3-472s21c1
Sequence:CCGGGCAGAGAGCAAAGTCTTCTATCTCGAGATAGAAGACTTTGCTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003406.3-660s21c1
Sequence:CCGGCTCTGTGTTCTATTATGAGATCTCGAGATCTCATAATAGAACACAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003406.3-373s21c1
Sequence:CCGGGCTCGAGAATACAGAGAGAAACTCGAGTTTCTCTCTGTATTCTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003406.3-792s21c1
Sequence:CCGGGCAATTACTGAGAGACAACTTCTCGAGAAGTTGTCTCTCAGTAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks