EMAIL THIS PAGE TO A FRIEND

YY1

YY1 transcription factor

Synonyms: DELTA INO80S NF-E1 UCRBP YIN-YANG-1
UniProtKB ID: P25490, Q14935
Gene ID:
Human(7528) Summary: YY1 is a ubiquitously distributed transcription factor belonging to the GLI-Kruppel class of zinc finger proteins. The protein is involved in repressing and activating a diverse number of promoters. YY1 may direct histone deacetylases and histone acetyltransferases to a promoter in order to activate or repress the promoter, thus implicating histone modification in the function of YY1. [provided by RefSeq, Jul 2008]
Mouse(22632) YY1 transcription factor
Rat(24919) YY1 transcription factor
chicken(423455) YY1 transcription factor
dog(611171) YY1 transcription factor
domestic cat(101080802) YY1 transcription factor
cow(534353) YY1 transcription factor
naked mole-rat(101705706) YY1 transcription factor
118 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV38301 Anti-YY1 (AB1) antibody produced in rabbit affinity isolated antibody , mouse, canine, zebrafish, bovine, rat, human, horse
western blot pricing
AV100898 Anti-YY1 (AB2) antibody produced in rabbit affinity isolated antibody human, canine, mouse, bovine, zebrafish, rat
immunohistochemistry, western blot pricing
AV100899 Anti-YY1 (AB3) antibody produced in rabbit affinity isolated antibody human, rat, mouse, bovine, canine
western blot pricing
SAB4200303 Anti-YY1 (N-terminal) antibody produced in rabbit Ig fraction of antiserum human
western blot pricing
SAB1406605 Anti-YY1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB1412082 ANTI-YY1 antibody produced in mouse clone 4D2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412083 ANTI-YY1 antibody produced in mouse clone 2C5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412084 ANTI-YY1 antibody produced in mouse clone 4C1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA001119 Anti-YY1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB4200302 Anti-YY1 antibody produced in rabbit IgG fraction of antiserum human, rat
western blot pricing
WH0007528M1 Monoclonal Anti-YY1 antibody produced in mouse clone 2C4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1404533 Monoclonal Anti-YY1 antibody produced in mouse clone 4A5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
PLA0268 Rabbit anti-YY1 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. rhesus monkey, rat, marmoset, human, ferret, sheep, dog, mouse, gorilla, bovine
immunofluorescence, immunohistochemistry, immunoprecipitation, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009537 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009537 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009537 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003403 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003403 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003403 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU043571 MISSION® esiRNA esiRNA human YY1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003403 Rosetta Predictions human pricing
NM_173290 Rosetta Predictions rat pricing
NM_009537 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003403 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155071 predicted 1631
2 SASI_Hs01_00155072 predicted 1394
3 SASI_Hs01_00155073 predicted 1633
4 SASI_Hs01_00155075 predicted 1368
5 SASI_Hs01_00155076 predicted 1395
6 SASI_Hs01_00155077 predicted 1366
7 SASI_Hs02_00335591 predicted 1396
8 SASI_Hs02_00335592 predicted 1583
9 SASI_Hs02_00335593 predicted 1388
10 SASI_Hs02_00335594 predicted 1592
11 SASI_Hs01_00155069 predicted 1657
12 SASI_Hs01_00155070 predicted 1446
13 SASI_Hs01_00155074 predicted 1451
14 SASI_Hs01_00155078 predicted 1441
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173290 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00085458 predicted 895
2 SASI_Rn02_00269352 predicted 984
3 SASI_Rn01_00085460 predicted 1007
4 SASI_Rn01_00085461 predicted 953
5 SASI_Rn01_00085462 predicted 990
6 SASI_Rn01_00085463 predicted 884
7 SASI_Rn01_00085464 predicted 909
8 SASI_Rn01_00085465 predicted 972
9 SASI_Rn01_00085466 predicted 445
10 SASI_Rn02_00269353 predicted 945
11 SASI_Rn01_00085457 predicted 979
12 SASI_Rn01_00085459 predicted 993
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009537 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00125709 predicted 1003
2 SASI_Mm01_00125710 predicted 1149
3 SASI_Mm01_00125711 predicted 1458
4 SASI_Mm02_00316365 predicted 1084
5 SASI_Mm01_00125712 predicted 1628
6 SASI_Mm02_00316366 predicted 1205
7 SASI_Mm01_00125713 predicted 1272
8 SASI_Mm01_00125714 predicted 1539
9 SASI_Mm01_00125715 predicted 1527
10 SASI_Mm01_00125716 predicted 1519
11 SASI_Mm01_00125717 predicted 1632
12 SASI_Mm01_00125718 predicted 1315
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009537
VALIDATED
YY1 MISSION shRNA Bacterial Glycerol Stock
YY1 transcription factor
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009537.3-811s21c1
Sequence:CCGGGTGGTTGAAGAGCAGATCATTCTCGAGAATGATCTGCTCTTCAACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009537.3-1310s21c1
Sequence:CCGGACATCTTAACACACGCTAAAGCTCGAGCTTTAGCGTGTGTTAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009537.3-918s21c1
Sequence:CCGGCCCTAAGCAACTGGCAGAATTCTCGAGAATTCTGCCAGTTGCTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009537.3-1263s21c1
Sequence:CCGGCGACGGTTGTAATAAGAAGTTCTCGAGAACTTCTTATTACAACCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312837    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009537.3-1523s21c1
Sequence:CCGGACATTGCTAAGATGCTATATCCTCGAGGATATAGCATCTTAGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009537.2-1263s1c1
Sequence:CCGGCGACGGTTGTAATAAGAAGTTCTCGAGAACTTCTTATTACAACCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009537.2-995s1c1
Sequence:CCGGGCCCTCATAAAGGCTGCACAACTCGAGTTGTGCAGCCTTTATGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009537.2-918s1c1
Sequence:CCGGCCCTAAGCAACTGGCAGAATTCTCGAGAATTCTGCCAGTTGCTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009537.2-811s1c1
Sequence:CCGGGTGGTTGAAGAGCAGATCATTCTCGAGAATGATCTGCTCTTCAACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009537.2-1309s1c1
Sequence:CCGGCACATCTTAACACACGCTAAACTCGAGTTTAGCGTGTGTTAAGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009537
VALIDATED
YY1 MISSION shRNA shRNA Plasmid DNA
YY1 transcription factor
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009537.3-811s21c1
Sequence:CCGGGTGGTTGAAGAGCAGATCATTCTCGAGAATGATCTGCTCTTCAACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009537.3-1310s21c1
Sequence:CCGGACATCTTAACACACGCTAAAGCTCGAGCTTTAGCGTGTGTTAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009537.3-918s21c1
Sequence:CCGGCCCTAAGCAACTGGCAGAATTCTCGAGAATTCTGCCAGTTGCTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009537.3-1263s21c1
Sequence:CCGGCGACGGTTGTAATAAGAAGTTCTCGAGAACTTCTTATTACAACCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312837    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009537.3-1523s21c1
Sequence:CCGGACATTGCTAAGATGCTATATCCTCGAGGATATAGCATCTTAGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009537.2-1263s1c1
Sequence:CCGGCGACGGTTGTAATAAGAAGTTCTCGAGAACTTCTTATTACAACCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009537.2-995s1c1
Sequence:CCGGGCCCTCATAAAGGCTGCACAACTCGAGTTGTGCAGCCTTTATGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009537.2-918s1c1
Sequence:CCGGCCCTAAGCAACTGGCAGAATTCTCGAGAATTCTGCCAGTTGCTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009537.2-811s1c1
Sequence:CCGGGTGGTTGAAGAGCAGATCATTCTCGAGAATGATCTGCTCTTCAACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009537.2-1309s1c1
Sequence:CCGGCACATCTTAACACACGCTAAACTCGAGTTTAGCGTGTGTTAAGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009537
VALIDATED
YY1 MISSION shRNA Lentiviral Transduction Particles
YY1 transcription factor
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009537.3-811s21c1
Sequence:CCGGGTGGTTGAAGAGCAGATCATTCTCGAGAATGATCTGCTCTTCAACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009537.3-1310s21c1
Sequence:CCGGACATCTTAACACACGCTAAAGCTCGAGCTTTAGCGTGTGTTAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009537.3-918s21c1
Sequence:CCGGCCCTAAGCAACTGGCAGAATTCTCGAGAATTCTGCCAGTTGCTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009537.3-1263s21c1
Sequence:CCGGCGACGGTTGTAATAAGAAGTTCTCGAGAACTTCTTATTACAACCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312837    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009537.3-1523s21c1
Sequence:CCGGACATTGCTAAGATGCTATATCCTCGAGGATATAGCATCTTAGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009537.2-1263s1c1
Sequence:CCGGCGACGGTTGTAATAAGAAGTTCTCGAGAACTTCTTATTACAACCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009537.2-995s1c1
Sequence:CCGGGCCCTCATAAAGGCTGCACAACTCGAGTTGTGCAGCCTTTATGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009537.2-918s1c1
Sequence:CCGGCCCTAAGCAACTGGCAGAATTCTCGAGAATTCTGCCAGTTGCTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009537.2-811s1c1
Sequence:CCGGGTGGTTGAAGAGCAGATCATTCTCGAGAATGATCTGCTCTTCAACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009537.2-1309s1c1
Sequence:CCGGCACATCTTAACACACGCTAAACTCGAGTTTAGCGTGTGTTAAGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003403
VALIDATED
YY1 MISSION shRNA Bacterial Glycerol Stock
YY1 transcription factor
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003403.3-1641s21c1
Sequence:CCGGCGATGGTTGTAATAAGAAGTTCTCGAGAACTTCTTATTACAACCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003403.3-1297s21c1
Sequence:CCGGCCCAAACAACTGGCAGAATTTCTCGAGAAATTCTGCCAGTTGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003403.3-1222s21c1
Sequence:CCGGCCTCCTGATTATTCAGAATATCTCGAGATATTCTGAATAATCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297381    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003403.3-1793s21c1
Sequence:CCGGGCCTCTCCTTTGTATATTATTCTCGAGAATAATATACAAAGGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003403.3-904s21c1
Sequence:CCGGGACGACGACTACATTGAACAACTCGAGTTGTTCAATGTAGTCGTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019894    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003403.3-1793s1c1
Sequence:CCGGGCCTCTCCTTTGTATATTATTCTCGAGAATAATATACAAAGGAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003403.3-1297s1c1
Sequence:CCGGCCCAAACAACTGGCAGAATTTCTCGAGAAATTCTGCCAGTTGTTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003403.3-1222s1c1
Sequence:CCGGCCTCCTGATTATTCAGAATATCTCGAGATATTCTGAATAATCAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003403.3-904s1c1
Sequence:CCGGGACGACGACTACATTGAACAACTCGAGTTGTTCAATGTAGTCGTCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003403.3-1641s1c1
Sequence:CCGGCGATGGTTGTAATAAGAAGTTCTCGAGAACTTCTTATTACAACCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003403
VALIDATED
YY1 MISSION shRNA shRNA Plasmid DNA
YY1 transcription factor
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003403.3-1641s21c1
Sequence:CCGGCGATGGTTGTAATAAGAAGTTCTCGAGAACTTCTTATTACAACCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003403.3-1297s21c1
Sequence:CCGGCCCAAACAACTGGCAGAATTTCTCGAGAAATTCTGCCAGTTGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003403.3-1222s21c1
Sequence:CCGGCCTCCTGATTATTCAGAATATCTCGAGATATTCTGAATAATCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297381    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003403.3-1793s21c1
Sequence:CCGGGCCTCTCCTTTGTATATTATTCTCGAGAATAATATACAAAGGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003403.3-904s21c1
Sequence:CCGGGACGACGACTACATTGAACAACTCGAGTTGTTCAATGTAGTCGTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019894    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003403.3-1793s1c1
Sequence:CCGGGCCTCTCCTTTGTATATTATTCTCGAGAATAATATACAAAGGAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003403.3-1297s1c1
Sequence:CCGGCCCAAACAACTGGCAGAATTTCTCGAGAAATTCTGCCAGTTGTTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003403.3-1222s1c1
Sequence:CCGGCCTCCTGATTATTCAGAATATCTCGAGATATTCTGAATAATCAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003403.3-904s1c1
Sequence:CCGGGACGACGACTACATTGAACAACTCGAGTTGTTCAATGTAGTCGTCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003403.3-1641s1c1
Sequence:CCGGCGATGGTTGTAATAAGAAGTTCTCGAGAACTTCTTATTACAACCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003403
VALIDATED
YY1 MISSION shRNA Lentiviral Transduction Particles
YY1 transcription factor
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003403.3-1641s21c1
Sequence:CCGGCGATGGTTGTAATAAGAAGTTCTCGAGAACTTCTTATTACAACCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003403.3-1297s21c1
Sequence:CCGGCCCAAACAACTGGCAGAATTTCTCGAGAAATTCTGCCAGTTGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003403.3-1222s21c1
Sequence:CCGGCCTCCTGATTATTCAGAATATCTCGAGATATTCTGAATAATCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297381    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003403.3-1793s21c1
Sequence:CCGGGCCTCTCCTTTGTATATTATTCTCGAGAATAATATACAAAGGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003403.3-904s21c1
Sequence:CCGGGACGACGACTACATTGAACAACTCGAGTTGTTCAATGTAGTCGTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019894    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003403.3-1793s1c1
Sequence:CCGGGCCTCTCCTTTGTATATTATTCTCGAGAATAATATACAAAGGAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003403.3-1297s1c1
Sequence:CCGGCCCAAACAACTGGCAGAATTTCTCGAGAAATTCTGCCAGTTGTTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003403.3-1222s1c1
Sequence:CCGGCCTCCTGATTATTCAGAATATCTCGAGATATTCTGAATAATCAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003403.3-904s1c1
Sequence:CCGGGACGACGACTACATTGAACAACTCGAGTTGTTCAATGTAGTCGTCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003403.3-1641s1c1
Sequence:CCGGCGATGGTTGTAATAAGAAGTTCTCGAGAACTTCTTATTACAACCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks