EMAIL THIS PAGE TO A FRIEND

YY1AP1

YY1 associated protein 1

Synonyms: HCCA1 HCCA2 YAP YY1AP
Species: Human YY1AP1(55249)
Gene ID:
Human(55249) Summary: The encoded gene product presumably interacts with YY1 protein; however, its exact function is not known. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
68 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018253 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018253 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018253 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_139118 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139118 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139118 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018253 Rosetta Predictions human pricing
NM_139118 Rosetta Predictions human pricing
NM_139119 Rosetta Predictions human pricing
NM_139120 Rosetta Predictions human pricing
NM_139121 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018253 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078830 predicted 2116
2 SASI_Hs01_00078831 predicted 2118
3 SASI_Hs01_00078832 predicted 2033
4 SASI_Hs01_00078833 predicted 1400
5 SASI_Hs01_00078834 predicted 1355
6 SASI_Hs01_00078835 predicted 2257
7 SASI_Hs01_00078836 predicted 1366
8 SASI_Hs01_00078837 predicted 1580
9 SASI_Hs01_00078838 predicted 2166
10 SASI_Hs01_00078839 predicted 2116
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139118 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202760 predicted 1239
2 SASI_Hs01_00202762 predicted 539
3 SASI_Hs02_00364134 predicted 2387
4 SASI_Hs02_00364135 predicted 936
5 SASI_Hs02_00364136 predicted 2375
6 SASI_Hs01_00202757 predicted 2011
7 SASI_Hs01_00202758 predicted 1923
8 SASI_Hs01_00202759 predicted 1291
9 SASI_Hs01_00202761 predicted 2146
10 SASI_Hs01_00202763 predicted 1246
11 SASI_Hs01_00202764 predicted 478
12 SASI_Hs01_00202765 predicted 1463
13 SASI_Hs01_00202766 predicted 2053
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139119 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084292 predicted 1346
2 SASI_Hs02_00364137 predicted 586
3 SASI_Hs02_00364138 predicted 2489
4 SASI_Hs02_00364139 predicted 2478
5 SASI_Hs01_00084288 predicted 1913
6 SASI_Hs01_00084289 predicted 1908
7 SASI_Hs01_00084290 predicted 1818
8 SASI_Hs01_00084291 predicted 1193
9 SASI_Hs01_00084293 predicted 2052
10 SASI_Hs01_00084294 predicted 1148
11 SASI_Hs01_00084295 predicted 1364
12 SASI_Hs01_00084296 predicted 1953
13 SASI_Hs01_00084297 predicted 1910
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139120 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022074 predicted 1391
2 SASI_Hs01_00022075 predicted 1892
3 SASI_Hs01_00022076 predicted 1134
4 SASI_Hs01_00022077 predicted 2033
5 SASI_Hs01_00022078 predicted 1348
6 SASI_Hs01_00022079 predicted 1100
7 SASI_Hs01_00022080 predicted 1459
8 SASI_Hs01_00022081 predicted 1180
9 SASI_Hs01_00022082 predicted 1945
10 SASI_Hs01_00022083 predicted 1891
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139121 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089489 predicted 2069
2 SASI_Hs01_00089490 predicted 2064
3 SASI_Hs01_00089491 predicted 1975
4 SASI_Hs01_00089492 predicted 1350
5 SASI_Hs01_00089493 predicted 1307
6 SASI_Hs01_00089494 predicted 2202
7 SASI_Hs01_00089495 predicted 1308
8 SASI_Hs01_00089496 predicted 1519
9 SASI_Hs01_00089497 predicted 2118
10 SASI_Hs01_00089498 predicted 2064
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018253
VALIDATED
YY1AP1 MISSION shRNA Bacterial Glycerol Stock
YY1 associated protein 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000135460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_018253.2-2476s1c1
Sequence:CCGGGTTGTCAAGATGGAACCTGAACTCGAGTTCAGGTTCCATCTTGACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_018253.2-2119s1c1
Sequence:CCGGCCCTTAATTGTTTCTGGCAATCTCGAGATTGCCAGAAACAATTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_018253.2-1927s1c1
Sequence:CCGGGCATCTGTTATCTTCACTGTTCTCGAGAACAGTGAAGATAACAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_018253.2-442s1c1
Sequence:CCGGCAGATAGCGAAGGAACTATTTCTCGAGAAATAGTTCCTTCGCTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018253.2-995s1c1
Sequence:CCGGCTGAGGACAATTTGTTAGCTTCTCGAGAAGCTAACAAATTGTCCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018253.2-1135s1c1
Sequence:CCGGGCTCCTGACAACATCATTAAACTCGAGTTTAATGATGTTGTCAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018253
VALIDATED
YY1AP1 MISSION shRNA shRNA Plasmid DNA
YY1 associated protein 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000135460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_018253.2-2476s1c1
Sequence:CCGGGTTGTCAAGATGGAACCTGAACTCGAGTTCAGGTTCCATCTTGACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_018253.2-2119s1c1
Sequence:CCGGCCCTTAATTGTTTCTGGCAATCTCGAGATTGCCAGAAACAATTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_018253.2-1927s1c1
Sequence:CCGGGCATCTGTTATCTTCACTGTTCTCGAGAACAGTGAAGATAACAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_018253.2-442s1c1
Sequence:CCGGCAGATAGCGAAGGAACTATTTCTCGAGAAATAGTTCCTTCGCTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018253.2-995s1c1
Sequence:CCGGCTGAGGACAATTTGTTAGCTTCTCGAGAAGCTAACAAATTGTCCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018253.2-1135s1c1
Sequence:CCGGGCTCCTGACAACATCATTAAACTCGAGTTTAATGATGTTGTCAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018253
VALIDATED
YY1AP1 MISSION shRNA Lentiviral Transduction Particles
YY1 associated protein 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000135460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_018253.2-2476s1c1
Sequence:CCGGGTTGTCAAGATGGAACCTGAACTCGAGTTCAGGTTCCATCTTGACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_018253.2-2119s1c1
Sequence:CCGGCCCTTAATTGTTTCTGGCAATCTCGAGATTGCCAGAAACAATTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_018253.2-1927s1c1
Sequence:CCGGGCATCTGTTATCTTCACTGTTCTCGAGAACAGTGAAGATAACAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_018253.2-442s1c1
Sequence:CCGGCAGATAGCGAAGGAACTATTTCTCGAGAAATAGTTCCTTCGCTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018253.2-995s1c1
Sequence:CCGGCTGAGGACAATTTGTTAGCTTCTCGAGAAGCTAACAAATTGTCCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018253.2-1135s1c1
Sequence:CCGGGCTCCTGACAACATCATTAAACTCGAGTTTAATGATGTTGTCAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139118
YY1AP1 MISSION shRNA Bacterial Glycerol Stock
YY1 associated protein 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139118.1-1021s21c1
Sequence:CCGGGCTCCTGACAACATCATTAAACTCGAGTTTAATGATGTTGTCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139118.1-308s21c1
Sequence:CCGGCTGAGCCTCAAGCTAACTTTACTCGAGTAAAGTTAGCTTGAGGCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139118.1-357s21c1
Sequence:CCGGACTACTGGCCAACCTACTAAACTCGAGTTTAGTAGGTTGGCCAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139118.1-388s21c1
Sequence:CCGGCAGATAGCGAAGGAACTATTTCTCGAGAAATAGTTCCTTCGCTATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275072    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139118.1-2422s21c1
Sequence:CCGGAGAATAAGAGTCTGGAGACTGCTCGAGCAGTCTCCAGACTCTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139118
YY1AP1 MISSION shRNA shRNA Plasmid DNA
YY1 associated protein 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139118.1-1021s21c1
Sequence:CCGGGCTCCTGACAACATCATTAAACTCGAGTTTAATGATGTTGTCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139118.1-308s21c1
Sequence:CCGGCTGAGCCTCAAGCTAACTTTACTCGAGTAAAGTTAGCTTGAGGCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139118.1-357s21c1
Sequence:CCGGACTACTGGCCAACCTACTAAACTCGAGTTTAGTAGGTTGGCCAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139118.1-388s21c1
Sequence:CCGGCAGATAGCGAAGGAACTATTTCTCGAGAAATAGTTCCTTCGCTATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275072    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139118.1-2422s21c1
Sequence:CCGGAGAATAAGAGTCTGGAGACTGCTCGAGCAGTCTCCAGACTCTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139118
YY1AP1 MISSION shRNA Lentiviral Transduction Particles
YY1 associated protein 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139118.1-1021s21c1
Sequence:CCGGGCTCCTGACAACATCATTAAACTCGAGTTTAATGATGTTGTCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139118.1-308s21c1
Sequence:CCGGCTGAGCCTCAAGCTAACTTTACTCGAGTAAAGTTAGCTTGAGGCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139118.1-357s21c1
Sequence:CCGGACTACTGGCCAACCTACTAAACTCGAGTTTAGTAGGTTGGCCAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139118.1-388s21c1
Sequence:CCGGCAGATAGCGAAGGAACTATTTCTCGAGAAATAGTTCCTTCGCTATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275072    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139118.1-2422s21c1
Sequence:CCGGAGAATAAGAGTCTGGAGACTGCTCGAGCAGTCTCCAGACTCTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks