EMAIL THIS PAGE TO A FRIEND

YY2

YY2 transcription factor

Synonyms: ZNF631
UniProtKB ID: O15391, B2RP10, Q6Q1S4
Gene ID:
Human(404281) Summary: The protein encoded by this gene is a transcription factor that includes several Kruppel-like zinc fingers in its C-terminal region. It possesses both activation and repression domains, and it can therefore have both positive and negative effects on the transcription of target genes. This gene has an intronless coding region, and it appears to have arisen by retrotransposition of the related YY1 transcription factor gene, which is located on chromosome 14. [provided by RefSeq, May 2010]
Mouse(100073351) Yy2 transcription factor
Rat(100361836) YY2 transcription factor
domestic cat(101084517) YY2 transcription factor
30 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_206923 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_206923 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_206923 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU100661 MISSION® esiRNA esiRNA human YY2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_206923 Rosetta Predictions human pricing
NM_001098723 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206923 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038703 predicted 615
2 SASI_Hs01_00038704 predicted 237
3 SASI_Hs01_00038705 predicted 321
4 SASI_Hs01_00038706 predicted 219
5 SASI_Hs01_00038707 predicted 760
6 SASI_Hs01_00038708 predicted 396
7 SASI_Hs01_00038709 predicted 787
8 SASI_Hs01_00038710 predicted 303
9 SASI_Hs01_00038711 predicted 285
10 SASI_Hs01_00038712 predicted 867
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098723 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00301431 predicted 1112
2 SASI_Mm02_00301432 predicted 393
3 SASI_Mm02_00301433 predicted 1391
4 SASI_Mm02_00301434 predicted 1367
5 SASI_Mm02_00301435 predicted 1257
6 SASI_Mm02_00301436 predicted 468
7 SASI_Mm02_00301437 predicted 770
8 SASI_Mm02_00301438 predicted 571
9 SASI_Mm02_00301439 predicted 1281
10 SASI_Mm02_00301440 predicted 895
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_206923
YY2 MISSION shRNA Bacterial Glycerol Stock
YY2 transcription factor
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000420037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206923.2-37s21c1
Sequence:CCGGCTGGAGATCCCGGCAGATATTCTCGAGAATATCTGCCGGGATCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206923.2-379s21c1
Sequence:CCGGGCGGCATCAACATCAACATCACTCGAGTGATGTTGATGTTGATGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206923.1-618s1c1
Sequence:CCGGCCCACCTGATTATTCCGAGTACTCGAGTACTCGGAATAATCAGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206923.1-673s1c1
Sequence:CCGGCCAGGCATTGATCTCTCAGATCTCGAGATCTGAGAGATCAATGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206923.1-222s1c1
Sequence:CCGGCGACCAGGAAATGCTTATGTTCTCGAGAACATAAGCATTTCCTGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206923.1-568s1c1
Sequence:CCGGCCTAACGATAACAATGACCAACTCGAGTTGGTCATTGTTATCGTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206923.1-510s1c1
Sequence:CCGGGCAGAAGCAAATGCAGGTCAACTCGAGTTGACCTGCATTTGCTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_206923
YY2 MISSION shRNA shRNA Plasmid DNA
YY2 transcription factor
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000420037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206923.2-37s21c1
Sequence:CCGGCTGGAGATCCCGGCAGATATTCTCGAGAATATCTGCCGGGATCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206923.2-379s21c1
Sequence:CCGGGCGGCATCAACATCAACATCACTCGAGTGATGTTGATGTTGATGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206923.1-618s1c1
Sequence:CCGGCCCACCTGATTATTCCGAGTACTCGAGTACTCGGAATAATCAGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206923.1-673s1c1
Sequence:CCGGCCAGGCATTGATCTCTCAGATCTCGAGATCTGAGAGATCAATGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206923.1-222s1c1
Sequence:CCGGCGACCAGGAAATGCTTATGTTCTCGAGAACATAAGCATTTCCTGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206923.1-568s1c1
Sequence:CCGGCCTAACGATAACAATGACCAACTCGAGTTGGTCATTGTTATCGTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206923.1-510s1c1
Sequence:CCGGGCAGAAGCAAATGCAGGTCAACTCGAGTTGACCTGCATTTGCTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_206923
YY2 MISSION shRNA Lentiviral Transduction Particles
YY2 transcription factor
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000420037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206923.2-37s21c1
Sequence:CCGGCTGGAGATCCCGGCAGATATTCTCGAGAATATCTGCCGGGATCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206923.2-379s21c1
Sequence:CCGGGCGGCATCAACATCAACATCACTCGAGTGATGTTGATGTTGATGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206923.1-618s1c1
Sequence:CCGGCCCACCTGATTATTCCGAGTACTCGAGTACTCGGAATAATCAGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206923.1-673s1c1
Sequence:CCGGCCAGGCATTGATCTCTCAGATCTCGAGATCTGAGAGATCAATGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206923.1-222s1c1
Sequence:CCGGCGACCAGGAAATGCTTATGTTCTCGAGAACATAAGCATTTCCTGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206923.1-568s1c1
Sequence:CCGGCCTAACGATAACAATGACCAACTCGAGTTGGTCATTGTTATCGTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206923.1-510s1c1
Sequence:CCGGGCAGAAGCAAATGCAGGTCAACTCGAGTTGACCTGCATTTGCTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks