EMAIL THIS PAGE TO A FRIEND

ZACN

zinc activated ligand-gated ion channel

Synonyms: L2 LGICZ LGICZ1 ZAC ZAC1
UniProtKB ID: Q401N2, Q2TB29, Q6ZWK3, Q86YW4
Gene ID:
Human(353174) Summary: LGICZ1 is a zinc-activated ligand-gated ion channel that defines a new subgroup of the cysteine-loop superfamily of ligand-gated ion channels (Davies et al., 2003 [PubMed 12381728]
dog(483326) zinc activated ligand-gated ion channel
domestic cat(101096685) zinc activated ligand-gated ion channel
cow(789168) zinc activated ligand-gated ion channel
sheep(101106273) zinc activated ligand-gated ion channel
naked mole-rat(101720147) zinc activated ligand-gated ion channel
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2104248 Anti-LGICZ1, (N-terminal) antibody produced in rabbit affinity isolated antibody human, canine, bovine, horse, rabbit
western blot pricing
SAB1303226 ANTI-ZACN (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_180990 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_180990 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_180990 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_180990 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_180990 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161405 predicted 222
2 SASI_Hs01_00161407 predicted 566
3 SASI_Hs01_00161408 predicted 906
4 SASI_Hs01_00161409 predicted 276
5 SASI_Hs01_00161410 predicted 212
6 SASI_Hs01_00161411 predicted 547
7 SASI_Hs01_00161406 predicted 366
8 SASI_Hs01_00161412 predicted 39
9 SASI_Hs01_00161413 predicted 140
10 SASI_Hs01_00161414 predicted 143
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_180990
ZACN MISSION shRNA Bacterial Glycerol Stock
zinc activated ligand-gated ion channel
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180990.2-907s1c1
Sequence:CCGGCCCACTGCTCATTTACTACTTCTCGAGAAGTAGTAAATGAGCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180990.2-913s1c1
Sequence:CCGGGCTCATTTACTACTTCACCATCTCGAGATGGTGAAGTAGTAAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180990.2-494s1c1
Sequence:CCGGACGGAGACCAACTGCAACTTTCTCGAGAAAGTTGCAGTTGGTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180990.2-244s1c1
Sequence:CCGGCAACGTGTTTAATGTGGACATCTCGAGATGTCCACATTAAACACGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180990.2-268s1c1
Sequence:CCGGGCGATACACAATGTCCTCCATCTCGAGATGGAGGACATTGTGTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_180990.3-1172s21c1
Sequence:CCGGTGAGACTGCTGACCGCATCTTCTCGAGAAGATGCGGTCAGCAGTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_180990
ZACN MISSION shRNA shRNA Plasmid DNA
zinc activated ligand-gated ion channel
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180990.2-907s1c1
Sequence:CCGGCCCACTGCTCATTTACTACTTCTCGAGAAGTAGTAAATGAGCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180990.2-913s1c1
Sequence:CCGGGCTCATTTACTACTTCACCATCTCGAGATGGTGAAGTAGTAAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180990.2-494s1c1
Sequence:CCGGACGGAGACCAACTGCAACTTTCTCGAGAAAGTTGCAGTTGGTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180990.2-244s1c1
Sequence:CCGGCAACGTGTTTAATGTGGACATCTCGAGATGTCCACATTAAACACGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180990.2-268s1c1
Sequence:CCGGGCGATACACAATGTCCTCCATCTCGAGATGGAGGACATTGTGTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_180990.3-1172s21c1
Sequence:CCGGTGAGACTGCTGACCGCATCTTCTCGAGAAGATGCGGTCAGCAGTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_180990
ZACN MISSION shRNA Lentiviral Transduction Particles
zinc activated ligand-gated ion channel
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180990.2-907s1c1
Sequence:CCGGCCCACTGCTCATTTACTACTTCTCGAGAAGTAGTAAATGAGCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180990.2-913s1c1
Sequence:CCGGGCTCATTTACTACTTCACCATCTCGAGATGGTGAAGTAGTAAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180990.2-494s1c1
Sequence:CCGGACGGAGACCAACTGCAACTTTCTCGAGAAAGTTGCAGTTGGTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180990.2-244s1c1
Sequence:CCGGCAACGTGTTTAATGTGGACATCTCGAGATGTCCACATTAAACACGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180990.2-268s1c1
Sequence:CCGGGCGATACACAATGTCCTCCATCTCGAGATGGAGGACATTGTGTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_180990.3-1172s21c1
Sequence:CCGGTGAGACTGCTGACCGCATCTTCTCGAGAAGATGCGGTCAGCAGTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks