EMAIL THIS PAGE TO A FRIEND

ZADH2

zinc binding alcohol dehydrogenase domain containing 2

UniProtKB ID: Q8N4Q0, A8KA15
Gene ID:
Mouse(225791) zinc binding alcohol dehydrogenase, domain containing 2
Rat(291403) zinc binding alcohol dehydrogenase, domain containing 2
naked mole-rat(101706941) zinc binding alcohol dehydrogenase domain containing 2
domestic guinea pig(100729339) zinc binding alcohol dehydrogenase domain containing 2
cow(532505) zinc binding alcohol dehydrogenase domain containing 2
sheep(101110470) zinc binding alcohol dehydrogenase domain containing 2
chicken(421010) zinc binding alcohol dehydrogenase domain containing 2
domestic cat(101099754) zinc binding alcohol dehydrogenase domain containing 2
dog(476162) zinc binding alcohol dehydrogenase domain containing 2
175 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146090 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146090 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146090 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_175907 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175907 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175907 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU084561 MISSION® esiRNA esiRNA human ZADH2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_175907 Rosetta Predictions human pricing
NM_001106129 Rosetta Predictions rat pricing
NM_146090 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175907 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095864 predicted 1145
2 SASI_Hs01_00095865 predicted 652
3 SASI_Hs01_00095866 predicted 301
4 SASI_Hs01_00095868 predicted 975
5 SASI_Hs01_00095869 predicted 1016
6 SASI_Hs01_00095870 predicted 436
7 SASI_Hs02_00369168 predicted 543
8 SASI_Hs02_00369169 predicted 358
9 SASI_Hs01_00095871 predicted 376
10 SASI_Hs01_00095873 predicted 458
11 SASI_Hs01_00095867 predicted 917
12 SASI_Hs01_00095872 predicted 901
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106129 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215908 predicted 301
2 SASI_Rn02_00215909 predicted 1650
3 SASI_Rn02_00215910 predicted 1634
4 SASI_Rn02_00215911 predicted 508
5 SASI_Rn02_00215912 predicted 1543
6 SASI_Rn02_00215913 predicted 1647
7 SASI_Rn02_00215914 predicted 1676
8 SASI_Rn02_00215915 predicted 1665
9 SASI_Rn02_00215916 predicted 622
10 SASI_Rn02_00215917 predicted 873
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146090 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00166281 predicted 794
2 SASI_Mm01_00166283 predicted 1048
3 SASI_Mm01_00166284 predicted 1092
4 SASI_Mm01_00166285 predicted 785
5 SASI_Mm02_00341724 predicted 1044
6 SASI_Mm02_00341725 predicted 562
7 SASI_Mm01_00166287 predicted 221
8 SASI_Mm01_00166289 predicted 1166
9 SASI_Mm02_00341726 predicted 220
10 SASI_Mm02_00341727 predicted 369
11 SASI_Mm01_00166282 predicted 815
12 SASI_Mm01_00166286 predicted 571
13 SASI_Mm01_00166288 predicted 516
14 SASI_Mm01_00166290 predicted 480
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146090
VALIDATED
ZADH2 MISSION shRNA Bacterial Glycerol Stock
zinc binding alcohol dehydrogenase domain containing 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146090.5-800s21c1
Sequence:CCGGCGCTTGATAGTGATTGGGTTTCTCGAGAAACCCAATCACTATCAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324091    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146090.5-1597s21c1
Sequence:CCGGCCTCCCATCTAAATAGACATTCTCGAGAATGTCTATTTAGATGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146090.5-280s21c1
Sequence:CCGGGCCACCCTTTGACATAGGTTTCTCGAGAAACCTATGTCAAAGGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146090.5-839s21c1
Sequence:CCGGCCTACAGGACTCTCACCAATACTCGAGTATTGGTGAGAGTCCTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146090.5-209s21c1
Sequence:CCGGCGGAACCGATTCGTTGGTATTCTCGAGAATACCAACGAATCGGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114301    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146090.2-1598s1c1
Sequence:CCGGCCTCCCATCTAAATAGACATTCTCGAGAATGTCTATTTAGATGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146090.2-210s1c1
Sequence:CCGGCGGAACCGATTCGTTGGTATTCTCGAGAATACCAACGAATCGGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146090.2-840s1c1
Sequence:CCGGCCTACAGGACTCTCACCAATACTCGAGTATTGGTGAGAGTCCTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146090.2-281s1c1
Sequence:CCGGGCCACCCTTTGACATAGGTTTCTCGAGAAACCTATGTCAAAGGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146090.2-801s1c1
Sequence:CCGGCGCTTGATAGTGATTGGGTTTCTCGAGAAACCCAATCACTATCAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146090
VALIDATED
ZADH2 MISSION shRNA shRNA Plasmid DNA
zinc binding alcohol dehydrogenase domain containing 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146090.5-800s21c1
Sequence:CCGGCGCTTGATAGTGATTGGGTTTCTCGAGAAACCCAATCACTATCAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324091    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146090.5-1597s21c1
Sequence:CCGGCCTCCCATCTAAATAGACATTCTCGAGAATGTCTATTTAGATGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146090.5-280s21c1
Sequence:CCGGGCCACCCTTTGACATAGGTTTCTCGAGAAACCTATGTCAAAGGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146090.5-839s21c1
Sequence:CCGGCCTACAGGACTCTCACCAATACTCGAGTATTGGTGAGAGTCCTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146090.5-209s21c1
Sequence:CCGGCGGAACCGATTCGTTGGTATTCTCGAGAATACCAACGAATCGGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114301    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146090.2-1598s1c1
Sequence:CCGGCCTCCCATCTAAATAGACATTCTCGAGAATGTCTATTTAGATGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146090.2-210s1c1
Sequence:CCGGCGGAACCGATTCGTTGGTATTCTCGAGAATACCAACGAATCGGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146090.2-840s1c1
Sequence:CCGGCCTACAGGACTCTCACCAATACTCGAGTATTGGTGAGAGTCCTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146090.2-281s1c1
Sequence:CCGGGCCACCCTTTGACATAGGTTTCTCGAGAAACCTATGTCAAAGGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146090.2-801s1c1
Sequence:CCGGCGCTTGATAGTGATTGGGTTTCTCGAGAAACCCAATCACTATCAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146090
VALIDATED
ZADH2 MISSION shRNA Lentiviral Transduction Particles
zinc binding alcohol dehydrogenase domain containing 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146090.5-800s21c1
Sequence:CCGGCGCTTGATAGTGATTGGGTTTCTCGAGAAACCCAATCACTATCAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324091    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146090.5-1597s21c1
Sequence:CCGGCCTCCCATCTAAATAGACATTCTCGAGAATGTCTATTTAGATGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146090.5-280s21c1
Sequence:CCGGGCCACCCTTTGACATAGGTTTCTCGAGAAACCTATGTCAAAGGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146090.5-839s21c1
Sequence:CCGGCCTACAGGACTCTCACCAATACTCGAGTATTGGTGAGAGTCCTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146090.5-209s21c1
Sequence:CCGGCGGAACCGATTCGTTGGTATTCTCGAGAATACCAACGAATCGGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114301    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146090.2-1598s1c1
Sequence:CCGGCCTCCCATCTAAATAGACATTCTCGAGAATGTCTATTTAGATGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146090.2-210s1c1
Sequence:CCGGCGGAACCGATTCGTTGGTATTCTCGAGAATACCAACGAATCGGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146090.2-840s1c1
Sequence:CCGGCCTACAGGACTCTCACCAATACTCGAGTATTGGTGAGAGTCCTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146090.2-281s1c1
Sequence:CCGGGCCACCCTTTGACATAGGTTTCTCGAGAAACCTATGTCAAAGGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146090.2-801s1c1
Sequence:CCGGCGCTTGATAGTGATTGGGTTTCTCGAGAAACCCAATCACTATCAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175907
VALIDATED
ZADH2 MISSION shRNA Bacterial Glycerol Stock
zinc binding alcohol dehydrogenase domain containing 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175907.3-758s21c1
Sequence:CCGGGATCGTCCTATCAACTATAAACTCGAGTTTATAGTTGATAGGACGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230014    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175907.3-2507s21c1
Sequence:CCGGGTGAAGCCCACCAGATTATTTCTCGAGAAATAATCTGGTGGGCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175907.3-1218s21c1
Sequence:GTACCGGCTGTCAACAGTAAGCTGTAAACTCGAGTTTACAGCTTACTGTTGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175907.3-327s21c1
Sequence:GTACCGGATGCATCTGACATCAACTATTCTCGAGAATAGTTGATGTCAGATGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_175907.3-1150s21c1
Sequence:CCGGATTCCGTGCTGTCAATTATATCTCGAGATATAATTGACAGCACGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116002    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175907.3-1278s1c1
Sequence:CCGGGCACTTTATGTCTCAGAATTACTCGAGTAATTCTGAGACATAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_175907.3-1015s1c1
Sequence:CCGGCCTGAACCATTACCTTTCTAACTCGAGTTAGAAAGGTAATGGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_175907.3-1153s1c1
Sequence:CCGGCCGTGCTGTCAATTATATGTACTCGAGTACATATAATTGACAGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175907.3-305s1c1
Sequence:CCGGCGGAACCGATTTGTTGGTGTTCTCGAGAACACCAACAAATCGGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_175907.3-896s1c1
Sequence:CCGGCGCTTGATAGTAATAGGGTTTCTCGAGAAACCCTATTACTATCAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175907
VALIDATED
ZADH2 MISSION shRNA shRNA Plasmid DNA
zinc binding alcohol dehydrogenase domain containing 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175907.3-758s21c1
Sequence:CCGGGATCGTCCTATCAACTATAAACTCGAGTTTATAGTTGATAGGACGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230014    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175907.3-2507s21c1
Sequence:CCGGGTGAAGCCCACCAGATTATTTCTCGAGAAATAATCTGGTGGGCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175907.3-1218s21c1
Sequence:GTACCGGCTGTCAACAGTAAGCTGTAAACTCGAGTTTACAGCTTACTGTTGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175907.3-327s21c1
Sequence:GTACCGGATGCATCTGACATCAACTATTCTCGAGAATAGTTGATGTCAGATGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_175907.3-1150s21c1
Sequence:CCGGATTCCGTGCTGTCAATTATATCTCGAGATATAATTGACAGCACGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116002    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175907.3-1278s1c1
Sequence:CCGGGCACTTTATGTCTCAGAATTACTCGAGTAATTCTGAGACATAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_175907.3-1015s1c1
Sequence:CCGGCCTGAACCATTACCTTTCTAACTCGAGTTAGAAAGGTAATGGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_175907.3-1153s1c1
Sequence:CCGGCCGTGCTGTCAATTATATGTACTCGAGTACATATAATTGACAGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175907.3-305s1c1
Sequence:CCGGCGGAACCGATTTGTTGGTGTTCTCGAGAACACCAACAAATCGGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_175907.3-896s1c1
Sequence:CCGGCGCTTGATAGTAATAGGGTTTCTCGAGAAACCCTATTACTATCAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175907
VALIDATED
ZADH2 MISSION shRNA Lentiviral Transduction Particles
zinc binding alcohol dehydrogenase domain containing 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175907.3-758s21c1
Sequence:CCGGGATCGTCCTATCAACTATAAACTCGAGTTTATAGTTGATAGGACGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230014    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175907.3-2507s21c1
Sequence:CCGGGTGAAGCCCACCAGATTATTTCTCGAGAAATAATCTGGTGGGCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175907.3-1218s21c1
Sequence:GTACCGGCTGTCAACAGTAAGCTGTAAACTCGAGTTTACAGCTTACTGTTGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175907.3-327s21c1
Sequence:GTACCGGATGCATCTGACATCAACTATTCTCGAGAATAGTTGATGTCAGATGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_175907.3-1150s21c1
Sequence:CCGGATTCCGTGCTGTCAATTATATCTCGAGATATAATTGACAGCACGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116002    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175907.3-1278s1c1
Sequence:CCGGGCACTTTATGTCTCAGAATTACTCGAGTAATTCTGAGACATAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_175907.3-1015s1c1
Sequence:CCGGCCTGAACCATTACCTTTCTAACTCGAGTTAGAAAGGTAATGGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_175907.3-1153s1c1
Sequence:CCGGCCGTGCTGTCAATTATATGTACTCGAGTACATATAATTGACAGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175907.3-305s1c1
Sequence:CCGGCGGAACCGATTTGTTGGTGTTCTCGAGAACACCAACAAATCGGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_175907.3-896s1c1
Sequence:CCGGCGCTTGATAGTAATAGGGTTTCTCGAGAAACCCTATTACTATCAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks