EMAIL THIS PAGE TO A FRIEND

ZAK

Synonyms: AZK MLK7 MLT MLTK MRK mlklak pk
Gene ID:
Human(51776) Summary: This gene is a member of the MAPKKK family of signal transduction molecules and encodes a protein with an N-terminal kinase catalytic domain, followed by a leucine zipper motif and a sterile-alpha motif (SAM). This magnesium-binding protein forms homodimers and is located in the cytoplasm. The protein mediates gamma radiation signaling leading to cell cycle arrest and activity of this protein plays a role in cell cycle checkpoint regulation in cells. The protein also has pro-apoptotic activity. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Mouse(65964) sterile alpha motif and leucine zipper containing kinase AZK
Rat(311743) sterile alpha motif and leucine zipper containing kinase AZK
chicken(424149) sterile alpha motif and leucine zipper containing kinase AZK
dog(478802) sterile alpha motif and leucine zipper containing kinase AZK
cow(519251) sterile alpha motif and leucine zipper containing kinase AZK
Gene Class: Cytoskeleton
225 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023057 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023057 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023057 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016653 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016653 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016653 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016653 Rosetta Predictions human pricing
NM_133646 Rosetta Predictions human pricing
XM_001059755 Rosetta Predictions rat pricing
XM_230983 Rosetta Predictions rat pricing
NM_023057 Rosetta Predictions mouse pricing
NM_178084 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016653 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060705 predicted 682
2 SASI_Hs01_00060706 predicted 866
3 SASI_Hs01_00060707 predicted 744
4 SASI_Hs01_00060708 predicted 457
5 SASI_Hs01_00060709 predicted 595
6 SASI_Hs01_00060710 predicted 936
7 SASI_Hs01_00060712 predicted 418
8 SASI_Hs01_00060713 predicted 466
9 SASI_Hs02_00349838 predicted 580
10 SASI_Hs02_00349839 predicted 632
11 SASI_Hs01_00060704 predicted 755
12 SASI_Hs01_00060711 predicted 358
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133646 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236002 predicted 685
2 SASI_Hs01_00236003 predicted 861
3 SASI_Hs01_00236004 predicted 741
4 SASI_Hs01_00236005 predicted 457
5 SASI_Hs01_00236006 predicted 604
6 SASI_Hs01_00236007 predicted 930
7 SASI_Hs01_00236009 predicted 420
8 SASI_Hs01_00236010 predicted 462
9 SASI_Hs02_00363289 predicted 581
10 SASI_Hs02_00363290 predicted 633
11 SASI_Hs01_00236001 predicted 755
12 SASI_Hs01_00236008 predicted 367
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059755 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00294230 predicted 920
2 SASI_Rn02_00294231 predicted 958
3 SASI_Rn02_00294232 predicted 898
4 SASI_Rn02_00294233 predicted 994
5 SASI_Rn02_00294234 predicted 947
6 SASI_Rn02_00294235 predicted 1237
7 SASI_Rn02_00294236 predicted 1097
8 SASI_Rn02_00294237 predicted 561
9 SASI_Rn02_00294238 predicted 1058
10 SASI_Rn02_00294239 predicted 1163
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_230983 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00123666 predicted 877
2 SASI_Rn01_00123667 predicted 913
3 SASI_Rn01_00123668 predicted 854
4 SASI_Rn01_00123669 predicted 957
5 SASI_Rn01_00123670 predicted 898
6 SASI_Rn01_00123671 predicted 1187
7 SASI_Rn01_00123672 predicted 1059
8 SASI_Rn01_00123673 predicted 432
9 SASI_Rn01_00123674 predicted 1247
10 SASI_Rn01_00123675 predicted 598
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023057 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00185712 predicted 260
2 SASI_Mm01_00185713 predicted 268
3 SASI_Mm01_00185714 predicted 294
4 SASI_Mm01_00185715 predicted 259
5 SASI_Mm01_00185716 predicted 204
6 SASI_Mm01_00185717 predicted 201
7 SASI_Mm02_00326758 predicted 259
8 SASI_Mm01_00185719 predicted 290
9 SASI_Mm01_00185720 predicted 287
10 SASI_Mm01_00185721 predicted 198
11 SASI_Mm01_00185718 predicted 224
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178084 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00144539 predicted 331
2 SASI_Mm01_00144540 predicted 338
3 SASI_Mm01_00144541 predicted 373
4 SASI_Mm01_00144542 predicted 335
5 SASI_Mm01_00144543 predicted 274
6 SASI_Mm01_00144544 predicted 280
7 SASI_Mm02_00348557 predicted 336
8 SASI_Mm01_00144546 predicted 372
9 SASI_Mm01_00144547 predicted 374
10 SASI_Mm01_00144548 predicted 282
11 SASI_Mm01_00144545 predicted 296
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023057
VALIDATED
ZAK MISSION shRNA Bacterial Glycerol Stock
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023057.1-63s1c1
Sequence:CCGGGCAAATTAAGTTCGACGACTTCTCGAGAAGTCGTCGAACTTAATTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023057.1-1260s1c1
Sequence:CCGGCCACGATTATCTGAACCTGTTCTCGAGAACAGGTTCAGATAATCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023057.1-787s1c1
Sequence:CCGGCCATCGTTCAAGCAAATCATTCTCGAGAATGATTTGCTTGAACGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023057.1-299s1c1
Sequence:CCGGGCTCCCTGTATGATTACATTACTCGAGTAATGTAATCATACAGGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023057.1-2061s1c1
Sequence:CCGGCCGAAGCAGAAACAAGTACTACTCGAGTAGTACTTGTTTCTGCTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023057.1-2061s1c2
Sequence:CCGGCCGAAGCAGAAACAAGTACTACTCGAGTAGTACTTGTTTCTGCTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023057.4-437s21c1
Sequence:CCGGCAAGTCAAGAAACGTTGTTATCTCGAGATAACAACGTTTCTTGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023057.4-786s21c1
Sequence:CCGGCCATCGTTCAAGCAAATCATTCTCGAGAATGATTTGCTTGAACGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322189    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023057.4-2622s21c1
Sequence:CCGGCAACTAGAGGTGGCAATTAAACTCGAGTTTAATTGCCACCTCTAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023057.4-1116s21c1
Sequence:CCGGATGAGTGGATACGCAAGTTTGCTCGAGCAAACTTGCGTATCCACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023057.4-1248s21c1
Sequence:CCGGGAGAAGCTAACCCACGATTATCTCGAGATAATCGTGGGTTAGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023057
VALIDATED
ZAK MISSION shRNA shRNA Plasmid DNA
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023057.1-63s1c1
Sequence:CCGGGCAAATTAAGTTCGACGACTTCTCGAGAAGTCGTCGAACTTAATTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023057.1-1260s1c1
Sequence:CCGGCCACGATTATCTGAACCTGTTCTCGAGAACAGGTTCAGATAATCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023057.1-787s1c1
Sequence:CCGGCCATCGTTCAAGCAAATCATTCTCGAGAATGATTTGCTTGAACGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023057.1-299s1c1
Sequence:CCGGGCTCCCTGTATGATTACATTACTCGAGTAATGTAATCATACAGGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023057.1-2061s1c1
Sequence:CCGGCCGAAGCAGAAACAAGTACTACTCGAGTAGTACTTGTTTCTGCTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023057.1-2061s1c2
Sequence:CCGGCCGAAGCAGAAACAAGTACTACTCGAGTAGTACTTGTTTCTGCTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023057.4-437s21c1
Sequence:CCGGCAAGTCAAGAAACGTTGTTATCTCGAGATAACAACGTTTCTTGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023057.4-786s21c1
Sequence:CCGGCCATCGTTCAAGCAAATCATTCTCGAGAATGATTTGCTTGAACGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322189    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023057.4-2622s21c1
Sequence:CCGGCAACTAGAGGTGGCAATTAAACTCGAGTTTAATTGCCACCTCTAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023057.4-1116s21c1
Sequence:CCGGATGAGTGGATACGCAAGTTTGCTCGAGCAAACTTGCGTATCCACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023057.4-1248s21c1
Sequence:CCGGGAGAAGCTAACCCACGATTATCTCGAGATAATCGTGGGTTAGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023057
VALIDATED
ZAK MISSION shRNA Lentiviral Transduction Particles
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023057.1-63s1c1
Sequence:CCGGGCAAATTAAGTTCGACGACTTCTCGAGAAGTCGTCGAACTTAATTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023057.1-1260s1c1
Sequence:CCGGCCACGATTATCTGAACCTGTTCTCGAGAACAGGTTCAGATAATCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023057.1-787s1c1
Sequence:CCGGCCATCGTTCAAGCAAATCATTCTCGAGAATGATTTGCTTGAACGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023057.1-299s1c1
Sequence:CCGGGCTCCCTGTATGATTACATTACTCGAGTAATGTAATCATACAGGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023057.1-2061s1c1
Sequence:CCGGCCGAAGCAGAAACAAGTACTACTCGAGTAGTACTTGTTTCTGCTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023057.1-2061s1c2
Sequence:CCGGCCGAAGCAGAAACAAGTACTACTCGAGTAGTACTTGTTTCTGCTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023057.4-437s21c1
Sequence:CCGGCAAGTCAAGAAACGTTGTTATCTCGAGATAACAACGTTTCTTGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023057.4-786s21c1
Sequence:CCGGCCATCGTTCAAGCAAATCATTCTCGAGAATGATTTGCTTGAACGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322189    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023057.4-2622s21c1
Sequence:CCGGCAACTAGAGGTGGCAATTAAACTCGAGTTTAATTGCCACCTCTAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023057.4-1116s21c1
Sequence:CCGGATGAGTGGATACGCAAGTTTGCTCGAGCAAACTTGCGTATCCACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023057.4-1248s21c1
Sequence:CCGGGAGAAGCTAACCCACGATTATCTCGAGATAATCGTGGGTTAGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016653
VALIDATED
ZAK MISSION shRNA Bacterial Glycerol Stock
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_016653.x-743s1c1
Sequence:CCGGACGAGAGATTAACCATTCCAACTCGAGTTGGAATGGTTAATCTCTCGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_016653.x-362s1c1
Sequence:CCGGACAGTAACAGAAGTGAGGAGACTCGAGTCTCCTCACTTCTGTTACTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_016653.x-255s1c1
Sequence:CCGGCCTCAGTCACAGAAACATCATCTCGAGATGATGTTTCTGTGACTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_016653.x-331s1c1
Sequence:CCGGGCTTCTCTGGGATCACTCTATCTCGAGATAGAGTGATCCCAGAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_016653.x-549s1c1
Sequence:CCGGCCATAACCATACAACACACATCTCGAGATGTGTGTTGTATGGTTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196939    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_016653.2-3433s1c1
Sequence:CCGGGCCTAGATTTGTGGTTCTTTCCTCGAGGAAAGAACCACAAATCTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016653.2-1623s1c1
Sequence:CCGGGATGTGACATTCAACACTAACCTCGAGGTTAGTGTTGAATGTCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_016653.2-751s1c1
Sequence:CCGGCAGAAACTTGTGACACATATTCTCGAGAATATGTGTCACAAGTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016653.2-294s1c1
Sequence:CCGGCGAGCCAAATGGATATCACAGCTCGAGCTGTGATATCCATTTGGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016653.2-1968s1c1
Sequence:CCGGCGTTCCCAGAGCAATCCTATTCTCGAGAATAGGATTGCTCTGGGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016653.2-2060s1c1
Sequence:CCGGGCCCATTAAGTATCAACAGATCTCGAGATCTGTTGATACTTAATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016653.2-377s21c1
Sequence:CCGGCCTCAGTCACAGAAACATCATCTCGAGATGATGTTTCTGTGACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016653.2-453s21c1
Sequence:CCGGGCTTCTCTGGGATCACTCTATCTCGAGATAGAGTGATCCCAGAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016653.2-865s21c1
Sequence:CCGGACGAGAGATTAACCATTCCAACTCGAGTTGGAATGGTTAATCTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016653.2-671s21c1
Sequence:CCGGCCATAACCATACAACACACATCTCGAGATGTGTGTTGTATGGTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016653
VALIDATED
ZAK MISSION shRNA shRNA Plasmid DNA
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_016653.x-743s1c1
Sequence:CCGGACGAGAGATTAACCATTCCAACTCGAGTTGGAATGGTTAATCTCTCGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_016653.x-362s1c1
Sequence:CCGGACAGTAACAGAAGTGAGGAGACTCGAGTCTCCTCACTTCTGTTACTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_016653.x-255s1c1
Sequence:CCGGCCTCAGTCACAGAAACATCATCTCGAGATGATGTTTCTGTGACTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_016653.x-331s1c1
Sequence:CCGGGCTTCTCTGGGATCACTCTATCTCGAGATAGAGTGATCCCAGAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_016653.x-549s1c1
Sequence:CCGGCCATAACCATACAACACACATCTCGAGATGTGTGTTGTATGGTTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196939    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_016653.2-3433s1c1
Sequence:CCGGGCCTAGATTTGTGGTTCTTTCCTCGAGGAAAGAACCACAAATCTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016653.2-1623s1c1
Sequence:CCGGGATGTGACATTCAACACTAACCTCGAGGTTAGTGTTGAATGTCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_016653.2-751s1c1
Sequence:CCGGCAGAAACTTGTGACACATATTCTCGAGAATATGTGTCACAAGTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016653.2-294s1c1
Sequence:CCGGCGAGCCAAATGGATATCACAGCTCGAGCTGTGATATCCATTTGGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016653.2-1968s1c1
Sequence:CCGGCGTTCCCAGAGCAATCCTATTCTCGAGAATAGGATTGCTCTGGGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016653.2-2060s1c1
Sequence:CCGGGCCCATTAAGTATCAACAGATCTCGAGATCTGTTGATACTTAATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016653.2-377s21c1
Sequence:CCGGCCTCAGTCACAGAAACATCATCTCGAGATGATGTTTCTGTGACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016653.2-453s21c1
Sequence:CCGGGCTTCTCTGGGATCACTCTATCTCGAGATAGAGTGATCCCAGAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016653.2-865s21c1
Sequence:CCGGACGAGAGATTAACCATTCCAACTCGAGTTGGAATGGTTAATCTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016653.2-671s21c1
Sequence:CCGGCCATAACCATACAACACACATCTCGAGATGTGTGTTGTATGGTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016653
VALIDATED
ZAK MISSION shRNA Lentiviral Transduction Particles
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_016653.x-743s1c1
Sequence:CCGGACGAGAGATTAACCATTCCAACTCGAGTTGGAATGGTTAATCTCTCGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_016653.x-362s1c1
Sequence:CCGGACAGTAACAGAAGTGAGGAGACTCGAGTCTCCTCACTTCTGTTACTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_016653.x-255s1c1
Sequence:CCGGCCTCAGTCACAGAAACATCATCTCGAGATGATGTTTCTGTGACTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_016653.x-331s1c1
Sequence:CCGGGCTTCTCTGGGATCACTCTATCTCGAGATAGAGTGATCCCAGAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_016653.x-549s1c1
Sequence:CCGGCCATAACCATACAACACACATCTCGAGATGTGTGTTGTATGGTTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196939    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_016653.2-3433s1c1
Sequence:CCGGGCCTAGATTTGTGGTTCTTTCCTCGAGGAAAGAACCACAAATCTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016653.2-1623s1c1
Sequence:CCGGGATGTGACATTCAACACTAACCTCGAGGTTAGTGTTGAATGTCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_016653.2-751s1c1
Sequence:CCGGCAGAAACTTGTGACACATATTCTCGAGAATATGTGTCACAAGTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016653.2-294s1c1
Sequence:CCGGCGAGCCAAATGGATATCACAGCTCGAGCTGTGATATCCATTTGGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016653.2-1968s1c1
Sequence:CCGGCGTTCCCAGAGCAATCCTATTCTCGAGAATAGGATTGCTCTGGGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016653.2-2060s1c1
Sequence:CCGGGCCCATTAAGTATCAACAGATCTCGAGATCTGTTGATACTTAATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016653.2-377s21c1
Sequence:CCGGCCTCAGTCACAGAAACATCATCTCGAGATGATGTTTCTGTGACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016653.2-453s21c1
Sequence:CCGGGCTTCTCTGGGATCACTCTATCTCGAGATAGAGTGATCCCAGAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016653.2-865s21c1
Sequence:CCGGACGAGAGATTAACCATTCCAACTCGAGTTGGAATGGTTAATCTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016653.2-671s21c1
Sequence:CCGGCCATAACCATACAACACACATCTCGAGATGTGTGTTGTATGGTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks