EMAIL THIS PAGE TO A FRIEND

ZAN

zonadhesin

Gene ID:
Human(7455) Summary: This gene encodes a sperm membrane protein that binds the zona pellucida of the egg in a species-specific manner. The encoded protein may be involved in signaling or gamete recognition. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Mouse(22635) zonadhesin
Rat(304379) zonadhesin
dog(489831) zonadhesin
Horse(100147025) zonadhesin
cow(530271) zonadhesin
sheep(101121143) zonadhesin
160 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1401401 Monoclonal Anti-ZAN antibody produced in mouse clone 2B6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003386 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003386 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003386 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011741 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011741 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011741 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU178921 MISSION® esiRNA esiRNA targeting mouse Zan mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003386 Rosetta Predictions human pricing
NM_173059 Rosetta Predictions human pricing
NM_001107134 Rosetta Predictions rat pricing
NM_011741 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003386 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163946 predicted 5707
2 SASI_Hs01_00163947 predicted 1410
3 SASI_Hs02_00335555 predicted 6416
4 SASI_Hs01_00163948 predicted 4021
5 SASI_Hs01_00163949 predicted 3308
6 SASI_Hs01_00163950 predicted 3830
7 SASI_Hs01_00163951 predicted 3240
8 SASI_Hs01_00163952 predicted 3441
9 SASI_Hs01_00163953 predicted 5369
10 SASI_Hs02_00335556 predicted 6901
11 SASI_Hs01_00163954 predicted 3989
12 SASI_Hs01_00163955 predicted 5116
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173059 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077858 predicted 5708
2 SASI_Hs01_00077859 predicted 1409
3 SASI_Hs02_00368044 predicted 6410
4 SASI_Hs01_00077860 predicted 4026
5 SASI_Hs01_00077861 predicted 3311
6 SASI_Hs01_00077862 predicted 3829
7 SASI_Hs01_00077863 predicted 3245
8 SASI_Hs01_00077864 predicted 3447
9 SASI_Hs01_00077865 predicted 5372
10 SASI_Hs02_00368045 predicted 6902
11 SASI_Hs01_00077866 predicted 3993
12 SASI_Hs01_00077867 predicted 5112
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107134 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225836 predicted 3063
2 SASI_Rn02_00225837 predicted 2550
3 SASI_Rn02_00225838 predicted 4588
4 SASI_Rn02_00225839 predicted 4397
5 SASI_Rn02_00225840 predicted 2084
6 SASI_Rn02_00225841 predicted 4667
7 SASI_Rn02_00225842 predicted 2264
8 SASI_Rn02_00225843 predicted 5321
9 SASI_Rn02_00225844 predicted 3071
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011741 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00138001 predicted 1043
2 SASI_Mm01_00138002 predicted 12390
3 SASI_Mm01_00138003 predicted 5947
4 SASI_Mm01_00138004 predicted 7030
5 SASI_Mm01_00138005 predicted 15613
6 SASI_Mm01_00138006 predicted 12455
7 SASI_Mm01_00138007 predicted 12399
8 SASI_Mm01_00138008 predicted 8219
9 SASI_Mm01_00138009 predicted 10022
10 SASI_Mm01_00138010 predicted 6563
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003386
ZAN MISSION shRNA Bacterial Glycerol Stock
zonadhesin
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000440222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003386.1-7213s21c1
Sequence:CCGGCAAGGCCGCATGACCTATGTTCTCGAGAACATAGGTCATGCGGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003386.1-328s21c1
Sequence:CCGGCAAGTGTCCGCAGACGATGAACTCGAGTTCATCGTCTGCGGACACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003386.1-417s21c1
Sequence:CCGGAGAGGGCAGCTATCTGCATATCTCGAGATATGCAGATAGCTGCCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003386.1-6413s1c1
Sequence:CCGGCCAGCGATGAAGTAGCAAATACTCGAGTATTTGCTACTTCATCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003386.1-1851s1c1
Sequence:CCGGCCCTACAATCTCCACCAAGAACTCGAGTTCTTGGTGGAGATTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003386.1-6184s1c1
Sequence:CCGGCGTGTGCTAATCAACAGCAAACTCGAGTTTGCTGTTGATTAGCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003386.1-6183s1c1
Sequence:CCGGCCGTGTGCTAATCAACAGCAACTCGAGTTGCTGTTGATTAGCACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003386.1-1074s1c1
Sequence:CCGGCCACATTTATGCTTCAGTCTTCTCGAGAAGACTGAAGCATAAATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003386
ZAN MISSION shRNA shRNA Plasmid DNA
zonadhesin
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000440222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003386.1-7213s21c1
Sequence:CCGGCAAGGCCGCATGACCTATGTTCTCGAGAACATAGGTCATGCGGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003386.1-328s21c1
Sequence:CCGGCAAGTGTCCGCAGACGATGAACTCGAGTTCATCGTCTGCGGACACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003386.1-417s21c1
Sequence:CCGGAGAGGGCAGCTATCTGCATATCTCGAGATATGCAGATAGCTGCCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003386.1-6413s1c1
Sequence:CCGGCCAGCGATGAAGTAGCAAATACTCGAGTATTTGCTACTTCATCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003386.1-1851s1c1
Sequence:CCGGCCCTACAATCTCCACCAAGAACTCGAGTTCTTGGTGGAGATTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003386.1-6184s1c1
Sequence:CCGGCGTGTGCTAATCAACAGCAAACTCGAGTTTGCTGTTGATTAGCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003386.1-6183s1c1
Sequence:CCGGCCGTGTGCTAATCAACAGCAACTCGAGTTGCTGTTGATTAGCACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003386.1-1074s1c1
Sequence:CCGGCCACATTTATGCTTCAGTCTTCTCGAGAAGACTGAAGCATAAATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003386
ZAN MISSION shRNA Lentiviral Transduction Particles
zonadhesin
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000440222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003386.1-7213s21c1
Sequence:CCGGCAAGGCCGCATGACCTATGTTCTCGAGAACATAGGTCATGCGGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003386.1-328s21c1
Sequence:CCGGCAAGTGTCCGCAGACGATGAACTCGAGTTCATCGTCTGCGGACACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003386.1-417s21c1
Sequence:CCGGAGAGGGCAGCTATCTGCATATCTCGAGATATGCAGATAGCTGCCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003386.1-6413s1c1
Sequence:CCGGCCAGCGATGAAGTAGCAAATACTCGAGTATTTGCTACTTCATCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003386.1-1851s1c1
Sequence:CCGGCCCTACAATCTCCACCAAGAACTCGAGTTCTTGGTGGAGATTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003386.1-6184s1c1
Sequence:CCGGCGTGTGCTAATCAACAGCAAACTCGAGTTTGCTGTTGATTAGCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003386.1-6183s1c1
Sequence:CCGGCCGTGTGCTAATCAACAGCAACTCGAGTTGCTGTTGATTAGCACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003386.1-1074s1c1
Sequence:CCGGCCACATTTATGCTTCAGTCTTCTCGAGAAGACTGAAGCATAAATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011741
ZAN MISSION shRNA Bacterial Glycerol Stock
zonadhesin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011741.1-3840s1c1
Sequence:CCGGCCCTACAACAACAAGCACTATCTCGAGATAGTGCTTGTTGTTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011741.1-950s1c1
Sequence:CCGGCCCTGGTAATGGCTACTACATCTCGAGATGTAGTAGCCATTACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011741.1-12747s1c1
Sequence:CCGGCCTGGCTATGTGGTGCATAATCTCGAGATTATGCACCACATAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011741.1-14829s1c1
Sequence:CCGGCGTATGAACTACTATCTCATACTCGAGTATGAGATAGTAGTTCATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011741.1-10051s1c1
Sequence:CCGGGCACCGAAATCACTCTACAATCTCGAGATTGTAGAGTGATTTCGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011741
ZAN MISSION shRNA shRNA Plasmid DNA
zonadhesin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011741.1-3840s1c1
Sequence:CCGGCCCTACAACAACAAGCACTATCTCGAGATAGTGCTTGTTGTTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011741.1-950s1c1
Sequence:CCGGCCCTGGTAATGGCTACTACATCTCGAGATGTAGTAGCCATTACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011741.1-12747s1c1
Sequence:CCGGCCTGGCTATGTGGTGCATAATCTCGAGATTATGCACCACATAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011741.1-14829s1c1
Sequence:CCGGCGTATGAACTACTATCTCATACTCGAGTATGAGATAGTAGTTCATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011741.1-10051s1c1
Sequence:CCGGGCACCGAAATCACTCTACAATCTCGAGATTGTAGAGTGATTTCGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011741
ZAN MISSION shRNA Lentiviral Transduction Particles
zonadhesin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011741.1-3840s1c1
Sequence:CCGGCCCTACAACAACAAGCACTATCTCGAGATAGTGCTTGTTGTTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011741.1-950s1c1
Sequence:CCGGCCCTGGTAATGGCTACTACATCTCGAGATGTAGTAGCCATTACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011741.1-12747s1c1
Sequence:CCGGCCTGGCTATGTGGTGCATAATCTCGAGATTATGCACCACATAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011741.1-14829s1c1
Sequence:CCGGCGTATGAACTACTATCTCATACTCGAGTATGAGATAGTAGTTCATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011741.1-10051s1c1
Sequence:CCGGGCACCGAAATCACTCTACAATCTCGAGATTGTAGAGTGATTTCGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks