EMAIL THIS PAGE TO A FRIEND

ZAP70

zeta-chain (TCR) associated protein kinase 70kDa

Synonyms: SRK STCD STD TZK ZAP-70
UniProtKB ID: P43403, A6NFP4, Q6PIA4, Q8IXD6, Q9UBS6
Gene ID:
Human(7535) Summary: This gene encodes an enzyme belonging to the protein tyrosine kinase family, and it plays a role in T-cell development and lymphocyte activation. This enzyme, which is phosphorylated on tyrosine residues upon T-cell antigen receptor (TCR) stimulation, functions in the initial step of TCR-mediated signal transduction in combination with the Src family kinases, Lck and Fyn. This enzyme is also essential for thymocyte development. Mutations in this gene cause selective T-cell defect, a severe combined immunodeficiency disease characterized by a selective absence of CD8-positive T-cells. Two transcript variants that encode different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(22637) zeta-chain (TCR) associated protein kinase
Rat(301348) zeta-chain (TCR) associated protein kinase 70
Zebrafish(553615) zeta-chain (TCR) associated protein kinase
domestic cat(101097059) zeta-chain (TCR) associated protein kinase 70kDa
dog(100271860) zeta-chain (TCR) associated protein kinase 70kDa
chicken(420086) zeta-chain (TCR) associated protein kinase 70kDa
cow(504509) zeta-chain (TCR) associated protein kinase 70kDa
sheep(101112639) zeta-chain (TCR) associated protein kinase 70kDa
Domestic Rabbit(100342021) zeta-chain (TCR) associated protein kinase 70kDa
naked mole-rat(101716577) zeta-chain (TCR) associated protein kinase 70kDa
domestic guinea pig(100713473) zeta-chain (TCR) associated protein kinase 70kDa
125 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4504011 Anti-phospho-ZAP-70 (pTyr292) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB4504012 Anti-phospho-ZAP-70 (pTyr315) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
Z0276 Anti-phospho-ZAP-70 (pTyr315/pTyr319) antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution mouse, human
western blot pricing
SAB4504570 Anti-phospho-ZAP-70 (pTyr319) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4504571 Anti-phospho-ZAP-70 (pTyr493) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4300130 Anti-phospho-ZAP70 (pTyr319) antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunofluorescence, western blot pricing
SAB4300131 Anti-phospho-ZAP70 (pTyr493) antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunohistochemistry, western blot pricing
SAB4503106 Anti-ZAP-70 antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, western blot pricing
SAB4503107 Anti-ZAP-70 antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, immunohistochemistry pricing
SAB4503108 Anti-ZAP-70 antibody produced in rabbit affinity isolated antibody mouse, human, rat
immunohistochemistry, western blot pricing
SAB4503109 Anti-ZAP-70, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry pricing
SAB4300437 Anti-ZAP70 (Ab-319) antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunohistochemistry, western blot pricing
SAB4300438 Anti-ZAP70 (Ab-493) antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunohistochemistry pricing
SAB2502042 Anti-ZAP70 antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, bovine, human, rat, canine
ELISA, western blot pricing
HPA003134 Anti-ZAP70 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB2107611 Anti-ZAP70 antibody produced in rabbit affinity isolated antibody rabbit, human, guinea pig, mouse, horse
ELISA, western blot pricing
Z0627 Monoclonal Anti-ZAP-70 antibody produced in mouse ~1.5 mg/mL, clone 1E7.2, purified immunoglobulin, buffered aqueous solution mouse, human
ELISA, flow cytometry, immunocytochemistry, immunoprecipitation, microarray, western blot pricing
SAB4700528 Monoclonal Anti-ZAP70 , (C-terminal) antibody produced in mouse clone ZAP-03, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
WH0007535M1 Monoclonal Anti-ZAP70 antibody produced in mouse clone 2F6, purified immunoglobulin, buffered aqueous solution human
ELISA pricing

ELISA

Product # Description Species Add to Cart
 
RAB1010 Phosphotyrosine ZAP70 / Tyrosine-protein Kinase ZAP-70 ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001079 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001079 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001079 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009539 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009539 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009539 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001079 Rosetta Predictions human pricing
NM_207519 Rosetta Predictions human pricing
NM_001012002 Rosetta Predictions rat pricing
XM_576543 Rosetta Predictions rat pricing
NM_009539 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219088 predicted 1726
2 SASI_Hs01_00219089 predicted 1493
3 SASI_Hs01_00219090 predicted 1921
4 SASI_Hs01_00219091 predicted 1599
5 SASI_Hs02_00313369 predicted 1876
6 SASI_Hs01_00219092 predicted 1674
7 SASI_Hs01_00219093 predicted 1401
8 SASI_Hs01_00219094 predicted 1496
9 SASI_Hs01_00219096 predicted 1343
10 SASI_Hs01_00219097 predicted 1851
11 SASI_Hs01_00219095 predicted 1364
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207519 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021954 predicted 748
2 SASI_Hs01_00021955 predicted 511
3 SASI_Hs01_00021956 predicted 934
4 SASI_Hs01_00021957 predicted 615
5 SASI_Hs02_00374148 predicted 893
6 SASI_Hs01_00021958 predicted 691
7 SASI_Hs01_00021959 predicted 416
8 SASI_Hs01_00021960 predicted 511
9 SASI_Hs01_00021962 predicted 359
10 SASI_Hs01_00021963 predicted 871
11 SASI_Hs01_00021961 predicted 388
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012002 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00057771 predicted 197
2 SASI_Rn01_00057772 predicted 1861
3 SASI_Rn02_00200060 predicted 1485
4 SASI_Rn01_00057774 predicted 727
5 SASI_Rn01_00057775 predicted 1184
6 SASI_Rn01_00057776 predicted 1151
7 SASI_Rn01_00057777 predicted 1223
8 SASI_Rn02_00200061 predicted 1070
9 SASI_Rn01_00057778 predicted 1355
10 SASI_Rn01_00057779 predicted 292
11 SASI_Rn01_00057773 predicted 1123
12 SASI_Rn01_00057780 predicted 1743
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576543 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00157294 predicted 1502
2 SASI_Rn01_00157295 predicted 1390
3 SASI_Rn01_00157296 predicted 1449
4 SASI_Rn01_00157297 predicted 1383
5 SASI_Rn01_00157298 predicted 1438
6 SASI_Rn01_00157299 predicted 1592
7 SASI_Rn01_00157300 predicted 1484
8 SASI_Rn01_00157301 predicted 1388
9 SASI_Rn01_00157302 predicted 1528
10 SASI_Rn01_00157303 predicted 1459
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009539 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00196329 predicted 1018
2 SASI_Mm01_00196330 predicted 1304
3 SASI_Mm02_00316367 predicted 1433
4 SASI_Mm01_00196332 predicted 1017
5 SASI_Mm01_00196333 predicted 1613
6 SASI_Mm02_00316368 predicted 1207
7 SASI_Mm01_00196334 predicted 1478
8 SASI_Mm01_00196336 predicted 823
9 SASI_Mm01_00196337 predicted 701
10 SASI_Mm02_00316369 predicted 1168
11 SASI_Mm01_00196331 predicted 1857
12 SASI_Mm01_00196335 predicted 1738
13 SASI_Mm01_00196338 predicted 1791
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001079
VALIDATED
ZAP70 MISSION shRNA Bacterial Glycerol Stock
zeta-chain (TCR) associated protein kinase 70kDa
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000000436    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_001079.x-2393s1c1
Sequence:CCGGCAGGCGTAGATCACCAGAATACTCGAGTATTCTGGTGATCTACGCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_001079.x-1820s1c1
Sequence:CCGGGAAGCCCTACAAGAAGATGAACTCGAGTTCATCTTCTTGTAGGGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_001079.x-834s1c1
Sequence:CCGGTACCACTACCTCATCAGCCAACTCGAGTTGGCTGATGAGGTAGTGGTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_001079.x-1211s1c1
Sequence:CCGGCGATAACCTCCTCATAGCTGACTCGAGTCAGCTATGAGGAGGTTATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_001079.x-1066s1c1
Sequence:CCGGCCCTCAACTCAGATGGATACACTCGAGTGTATCCATCTGAGTTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001079.3-1725s1c1
Sequence:CCGGCGCACCCGAATGCATCAACTTCTCGAGAAGTTGATGCATTCGGGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001079.3-913s1c1
Sequence:CCGGGTGGAGTATCTGAAGCTGAAGCTCGAGCTTCAGCTTCAGATACTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_001079.3-1600s1c1
Sequence:CCGGCGCAACGTCCTGCTGGTTAACCTCGAGGTTAACCAGCAGGACGTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_001079.3-1923s1c1
Sequence:CCGGGAGTGACTGCTGGATCTACAACTCGAGTTGTAGATCCAGCAGTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001079.3-884s1c1
Sequence:CCGGGCACCAAGTTTGACACGCTCTCTCGAGAGAGCGTGTCAAACTTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079.3-1627s21c1
Sequence:CCGGTACGCCAAGATCAGCGACTTTCTCGAGAAAGTCGCTGATCTTGGCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428505    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001079.3-2151s21c1
Sequence:CCGGTGCTTGGTTGTCTCCACACACCTCGAGGTGTGTGGAGACAACCAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079.3-1234s21c1
Sequence:CCGGGAACTTGGCTGCGGCAACTTTCTCGAGAAAGTTGCCGCAGCCAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079.3-1024s21c1
Sequence:CCGGCACCCATCCACGTTGACTCATCTCGAGATGAGTCAACGTGGATGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001079
VALIDATED
ZAP70 MISSION shRNA shRNA Plasmid DNA
zeta-chain (TCR) associated protein kinase 70kDa
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000000436    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_001079.x-2393s1c1
Sequence:CCGGCAGGCGTAGATCACCAGAATACTCGAGTATTCTGGTGATCTACGCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_001079.x-1820s1c1
Sequence:CCGGGAAGCCCTACAAGAAGATGAACTCGAGTTCATCTTCTTGTAGGGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_001079.x-834s1c1
Sequence:CCGGTACCACTACCTCATCAGCCAACTCGAGTTGGCTGATGAGGTAGTGGTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_001079.x-1211s1c1
Sequence:CCGGCGATAACCTCCTCATAGCTGACTCGAGTCAGCTATGAGGAGGTTATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_001079.x-1066s1c1
Sequence:CCGGCCCTCAACTCAGATGGATACACTCGAGTGTATCCATCTGAGTTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001079.3-1725s1c1
Sequence:CCGGCGCACCCGAATGCATCAACTTCTCGAGAAGTTGATGCATTCGGGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001079.3-913s1c1
Sequence:CCGGGTGGAGTATCTGAAGCTGAAGCTCGAGCTTCAGCTTCAGATACTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_001079.3-1600s1c1
Sequence:CCGGCGCAACGTCCTGCTGGTTAACCTCGAGGTTAACCAGCAGGACGTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_001079.3-1923s1c1
Sequence:CCGGGAGTGACTGCTGGATCTACAACTCGAGTTGTAGATCCAGCAGTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001079.3-884s1c1
Sequence:CCGGGCACCAAGTTTGACACGCTCTCTCGAGAGAGCGTGTCAAACTTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079.3-1627s21c1
Sequence:CCGGTACGCCAAGATCAGCGACTTTCTCGAGAAAGTCGCTGATCTTGGCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428505    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001079.3-2151s21c1
Sequence:CCGGTGCTTGGTTGTCTCCACACACCTCGAGGTGTGTGGAGACAACCAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079.3-1234s21c1
Sequence:CCGGGAACTTGGCTGCGGCAACTTTCTCGAGAAAGTTGCCGCAGCCAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079.3-1024s21c1
Sequence:CCGGCACCCATCCACGTTGACTCATCTCGAGATGAGTCAACGTGGATGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001079
VALIDATED
ZAP70 MISSION shRNA Lentiviral Transduction Particles
zeta-chain (TCR) associated protein kinase 70kDa
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000000436    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_001079.x-2393s1c1
Sequence:CCGGCAGGCGTAGATCACCAGAATACTCGAGTATTCTGGTGATCTACGCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_001079.x-1820s1c1
Sequence:CCGGGAAGCCCTACAAGAAGATGAACTCGAGTTCATCTTCTTGTAGGGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_001079.x-834s1c1
Sequence:CCGGTACCACTACCTCATCAGCCAACTCGAGTTGGCTGATGAGGTAGTGGTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_001079.x-1211s1c1
Sequence:CCGGCGATAACCTCCTCATAGCTGACTCGAGTCAGCTATGAGGAGGTTATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_001079.x-1066s1c1
Sequence:CCGGCCCTCAACTCAGATGGATACACTCGAGTGTATCCATCTGAGTTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001079.3-1725s1c1
Sequence:CCGGCGCACCCGAATGCATCAACTTCTCGAGAAGTTGATGCATTCGGGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001079.3-913s1c1
Sequence:CCGGGTGGAGTATCTGAAGCTGAAGCTCGAGCTTCAGCTTCAGATACTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_001079.3-1600s1c1
Sequence:CCGGCGCAACGTCCTGCTGGTTAACCTCGAGGTTAACCAGCAGGACGTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_001079.3-1923s1c1
Sequence:CCGGGAGTGACTGCTGGATCTACAACTCGAGTTGTAGATCCAGCAGTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001079.3-884s1c1
Sequence:CCGGGCACCAAGTTTGACACGCTCTCTCGAGAGAGCGTGTCAAACTTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079.3-1627s21c1
Sequence:CCGGTACGCCAAGATCAGCGACTTTCTCGAGAAAGTCGCTGATCTTGGCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428505    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001079.3-2151s21c1
Sequence:CCGGTGCTTGGTTGTCTCCACACACCTCGAGGTGTGTGGAGACAACCAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079.3-1234s21c1
Sequence:CCGGGAACTTGGCTGCGGCAACTTTCTCGAGAAAGTTGCCGCAGCCAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079.3-1024s21c1
Sequence:CCGGCACCCATCCACGTTGACTCATCTCGAGATGAGTCAACGTGGATGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009539
ZAP70 MISSION shRNA Bacterial Glycerol Stock
zeta-chain (TCR) associated protein kinase 70kDa
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009539.2-1481s1c1
Sequence:CCGGCGCAATGTTCTACTGGTCAATCTCGAGATTGACCAGTAGAACATTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009539.2-1781s1c1
Sequence:CCGGCCTCCTGAGATGTATGCACTTCTCGAGAAGTGCATACATCTCAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009539.2-823s1c1
Sequence:CCGGTGGACTAATTTACCGCTTGAACTCGAGTTCAAGCGGTAAATTAGTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009539.2-1051s1c1
Sequence:CCGGCCCTGAGGAACTCAAAGACAACTCGAGTTGTCTTTGAGTTCCTCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009539.2-1491s21c1
Sequence:CCGGTACTGGTCAATCGGCACTATGCTCGAGCATAGTGCCGATTGACCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009539.2-1858s21c1
Sequence:CCGGACAACGTATGCGGAACTATTACTCGAGTAATAGTTCCGCATACGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009539.2-813s21c1
Sequence:CCGGTGAAGGCGGATGGACTAATTTCTCGAGAAATTAGTCCATCCGCCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009539.2-1547s21c1
Sequence:CCGGGGTGCTGACGACAGCTATTACCTCGAGGTAATAGCTGTCGTCAGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009539
ZAP70 MISSION shRNA shRNA Plasmid DNA
zeta-chain (TCR) associated protein kinase 70kDa
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009539.2-1481s1c1
Sequence:CCGGCGCAATGTTCTACTGGTCAATCTCGAGATTGACCAGTAGAACATTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009539.2-1781s1c1
Sequence:CCGGCCTCCTGAGATGTATGCACTTCTCGAGAAGTGCATACATCTCAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009539.2-823s1c1
Sequence:CCGGTGGACTAATTTACCGCTTGAACTCGAGTTCAAGCGGTAAATTAGTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009539.2-1051s1c1
Sequence:CCGGCCCTGAGGAACTCAAAGACAACTCGAGTTGTCTTTGAGTTCCTCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009539.2-1491s21c1
Sequence:CCGGTACTGGTCAATCGGCACTATGCTCGAGCATAGTGCCGATTGACCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009539.2-1858s21c1
Sequence:CCGGACAACGTATGCGGAACTATTACTCGAGTAATAGTTCCGCATACGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009539.2-813s21c1
Sequence:CCGGTGAAGGCGGATGGACTAATTTCTCGAGAAATTAGTCCATCCGCCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009539.2-1547s21c1
Sequence:CCGGGGTGCTGACGACAGCTATTACCTCGAGGTAATAGCTGTCGTCAGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009539
ZAP70 MISSION shRNA Lentiviral Transduction Particles
zeta-chain (TCR) associated protein kinase 70kDa
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009539.2-1481s1c1
Sequence:CCGGCGCAATGTTCTACTGGTCAATCTCGAGATTGACCAGTAGAACATTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009539.2-1781s1c1
Sequence:CCGGCCTCCTGAGATGTATGCACTTCTCGAGAAGTGCATACATCTCAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009539.2-823s1c1
Sequence:CCGGTGGACTAATTTACCGCTTGAACTCGAGTTCAAGCGGTAAATTAGTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009539.2-1051s1c1
Sequence:CCGGCCCTGAGGAACTCAAAGACAACTCGAGTTGTCTTTGAGTTCCTCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009539.2-1491s21c1
Sequence:CCGGTACTGGTCAATCGGCACTATGCTCGAGCATAGTGCCGATTGACCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009539.2-1858s21c1
Sequence:CCGGACAACGTATGCGGAACTATTACTCGAGTAATAGTTCCGCATACGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009539.2-813s21c1
Sequence:CCGGTGAAGGCGGATGGACTAATTTCTCGAGAAATTAGTCCATCCGCCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009539.2-1547s21c1
Sequence:CCGGGGTGCTGACGACAGCTATTACCTCGAGGTAATAGCTGTCGTCAGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks