EMAIL THIS PAGE TO A FRIEND

ZAR1

zygote arrest 1

UniProtKB ID: Q86SH2
Gene ID:
Human(326340) Summary: The female gamete, the oocyte, serves the distinct purpose of transmitting the maternal genome and other maternal factors critical for postovulation events. Oocytes have diverse functions in ovarian folliculogenesis, fertilization, and embryogenesis. ZAR1 is an oocyte-specific gene that appears to function at the oocyte-to-gamete transition (Wu et al., 2003 [PubMed 12539046]
Mouse(317755) zygote arrest 1
Rat(353228) zygote arrest 1
naked mole-rat(101698857) zygote arrest 1
cow(540150) zygote arrest 1
sheep(100272222) zygote arrest 1
Thale Cress(824259) disease resistance RPP13-like protein 4
Zebrafish(369189) zygote arrest 1
chicken(100857604) zygote arrest 1
dog(100688284) zygote arrest 1
46 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175619 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175619 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175619 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_174877 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_174877 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_174877 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU216401 MISSION® esiRNA esiRNA targeting mouse Zar1 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_175619 Rosetta Predictions human pricing
NM_181385 Rosetta Predictions rat pricing
NM_174877 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175619 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059814 predicted 1189
2 SASI_Hs01_00059815 predicted 1076
3 SASI_Hs01_00059816 predicted 1146
4 SASI_Hs01_00059817 predicted 1026
5 SASI_Hs02_00369018 predicted 1049
6 SASI_Hs01_00059818 predicted 1194
7 SASI_Hs01_00059819 predicted 1113
8 SASI_Hs01_00059820 predicted 1109
9 SASI_Hs02_00369019 predicted 1041
10 SASI_Hs01_00059823 predicted 975
11 SASI_Hs01_00059821 predicted 1042
12 SASI_Hs01_00059822 predicted 1027
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181385 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00111031 predicted 812
2 SASI_Rn01_00111032 predicted 947
3 SASI_Rn01_00111033 predicted 196
4 SASI_Rn01_00111034 predicted 1041
5 SASI_Rn02_00269732 predicted 950
6 SASI_Rn01_00111035 predicted 887
7 SASI_Rn02_00269733 predicted 724
8 SASI_Rn02_00269734 predicted 432
9 SASI_Rn02_00269735 predicted 542
10 SASI_Rn01_00111038 predicted 415
11 SASI_Rn01_00111036 predicted 811
12 SASI_Rn01_00111037 predicted 917
13 SASI_Rn01_00111039 predicted 792
14 SASI_Rn01_00111040 predicted 933
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174877 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00179341 predicted 691
2 SASI_Mm01_00179342 predicted 815
3 SASI_Mm01_00179344 predicted 950
4 SASI_Mm01_00179345 predicted 642
5 SASI_Mm01_00179346 predicted 949
6 SASI_Mm01_00179347 predicted 1039
7 SASI_Mm01_00179348 predicted 952
8 SASI_Mm01_00179349 predicted 669
9 SASI_Mm02_00345521 predicted 543
10 SASI_Mm01_00179350 predicted 783
11 SASI_Mm01_00179343 predicted 922
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175619
ZAR1 MISSION shRNA Bacterial Glycerol Stock
zygote arrest 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175619.1-1268s21c1
Sequence:CCGGTCATTTAGGTGAAAGTCAGTGCTCGAGCACTGACTTTCACCTAAATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175619.1-1101s21c1
Sequence:CCGGCCCTTACCGAGTGGAGGATATCTCGAGATATCCTCCACTCGGTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131223    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175619.1-983s1c1
Sequence:CCGGGCTATTACCACTGCAAGGACTCTCGAGAGTCCTTGCAGTGGTAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175619.1-1136s1c1
Sequence:CCGGGTAAACAAACGAGATGTTCCTCTCGAGAGGAACATCTCGTTTGTTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175619.1-1204s1c1
Sequence:CCGGGATTTGTGCGGTAGATGCAAACTCGAGTTTGCATCTACCGCACAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175619.1-1077s1c1
Sequence:CCGGCAGAACTTGTCAGAAGTCTTACTCGAGTAAGACTTCTGACAAGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175619.1-1245s1c1
Sequence:CCGGCAGCACTTTCAGCTTCAAATACTCGAGTATTTGAAGCTGAAAGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175619.1-960s1c1
Sequence:CCGGCCAGTTCTTAGAGCAGAAATACTCGAGTATTTCTGCTCTAAGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129907    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175619.1-972s1c1
Sequence:CCGGGCAGAAATATGGCTATTACCACTCGAGTGGTAATAGCCATATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175619
ZAR1 MISSION shRNA shRNA Plasmid DNA
zygote arrest 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175619.1-1268s21c1
Sequence:CCGGTCATTTAGGTGAAAGTCAGTGCTCGAGCACTGACTTTCACCTAAATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175619.1-1101s21c1
Sequence:CCGGCCCTTACCGAGTGGAGGATATCTCGAGATATCCTCCACTCGGTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131223    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175619.1-983s1c1
Sequence:CCGGGCTATTACCACTGCAAGGACTCTCGAGAGTCCTTGCAGTGGTAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175619.1-1136s1c1
Sequence:CCGGGTAAACAAACGAGATGTTCCTCTCGAGAGGAACATCTCGTTTGTTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175619.1-1204s1c1
Sequence:CCGGGATTTGTGCGGTAGATGCAAACTCGAGTTTGCATCTACCGCACAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175619.1-1077s1c1
Sequence:CCGGCAGAACTTGTCAGAAGTCTTACTCGAGTAAGACTTCTGACAAGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175619.1-1245s1c1
Sequence:CCGGCAGCACTTTCAGCTTCAAATACTCGAGTATTTGAAGCTGAAAGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175619.1-960s1c1
Sequence:CCGGCCAGTTCTTAGAGCAGAAATACTCGAGTATTTCTGCTCTAAGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129907    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175619.1-972s1c1
Sequence:CCGGGCAGAAATATGGCTATTACCACTCGAGTGGTAATAGCCATATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175619
ZAR1 MISSION shRNA Lentiviral Transduction Particles
zygote arrest 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175619.1-1268s21c1
Sequence:CCGGTCATTTAGGTGAAAGTCAGTGCTCGAGCACTGACTTTCACCTAAATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175619.1-1101s21c1
Sequence:CCGGCCCTTACCGAGTGGAGGATATCTCGAGATATCCTCCACTCGGTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131223    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175619.1-983s1c1
Sequence:CCGGGCTATTACCACTGCAAGGACTCTCGAGAGTCCTTGCAGTGGTAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175619.1-1136s1c1
Sequence:CCGGGTAAACAAACGAGATGTTCCTCTCGAGAGGAACATCTCGTTTGTTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175619.1-1204s1c1
Sequence:CCGGGATTTGTGCGGTAGATGCAAACTCGAGTTTGCATCTACCGCACAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175619.1-1077s1c1
Sequence:CCGGCAGAACTTGTCAGAAGTCTTACTCGAGTAAGACTTCTGACAAGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175619.1-1245s1c1
Sequence:CCGGCAGCACTTTCAGCTTCAAATACTCGAGTATTTGAAGCTGAAAGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175619.1-960s1c1
Sequence:CCGGCCAGTTCTTAGAGCAGAAATACTCGAGTATTTCTGCTCTAAGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129907    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175619.1-972s1c1
Sequence:CCGGGCAGAAATATGGCTATTACCACTCGAGTGGTAATAGCCATATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174877
ZAR1 MISSION shRNA Bacterial Glycerol Stock
zygote arrest 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000202017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174877.2-933s1c1
Sequence:CCGGCTACAACCCTTACAGAGTGGACTCGAGTCCACTCTGTAAGGGTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174877.2-957s1c1
Sequence:CCGGCATCACCTGTCAAAGTTGTAACTCGAGTTACAACTTTGACAGGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174877.2-808s1c1
Sequence:CCGGGAGCAGAAGTACGGCTACTATCTCGAGATAGTAGCCGTACTTCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174877.2-1086s1c1
Sequence:CCGGCACCTTCAGCTTCAAATACATCTCGAGATGTATTTGAAGCTGAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174877
ZAR1 MISSION shRNA shRNA Plasmid DNA
zygote arrest 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000202017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174877.2-933s1c1
Sequence:CCGGCTACAACCCTTACAGAGTGGACTCGAGTCCACTCTGTAAGGGTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174877.2-957s1c1
Sequence:CCGGCATCACCTGTCAAAGTTGTAACTCGAGTTACAACTTTGACAGGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174877.2-808s1c1
Sequence:CCGGGAGCAGAAGTACGGCTACTATCTCGAGATAGTAGCCGTACTTCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174877.2-1086s1c1
Sequence:CCGGCACCTTCAGCTTCAAATACATCTCGAGATGTATTTGAAGCTGAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174877
ZAR1 MISSION shRNA Lentiviral Transduction Particles
zygote arrest 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000202017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174877.2-933s1c1
Sequence:CCGGCTACAACCCTTACAGAGTGGACTCGAGTCCACTCTGTAAGGGTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174877.2-957s1c1
Sequence:CCGGCATCACCTGTCAAAGTTGTAACTCGAGTTACAACTTTGACAGGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174877.2-808s1c1
Sequence:CCGGGAGCAGAAGTACGGCTACTATCTCGAGATAGTAGCCGTACTTCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174877.2-1086s1c1
Sequence:CCGGCACCTTCAGCTTCAAATACATCTCGAGATGTATTTGAAGCTGAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks