EMAIL THIS PAGE TO A FRIEND

ZAR1L

zygote arrest 1-like

Synonyms: ZAR2
UniProtKB ID: A6NP61, B2RV03, B7ZBU2
Gene ID:
Human(646799) Summary: This gene encodes a member of the ZAR1 family that is predominantly expressed in oocytes and early embryos. The protein may function as an RNA regulator in early embryos. [provided by RefSeq, Apr 2010]
Mouse(545824) zygote arrest 1-like
Rat(689594) zygote arrest 1-like
Zebrafish(561189) zygote arrest 1-like
chicken(771155) zygote arrest 1-like
domestic cat(101080255) zygote arrest 1-like
dog(477317) ZAR1-like protein-like
cow(616037) zygote arrest 1-like
cow(781080) ZAR1-like protein-like
sheep(101110248) zygote arrest 1-like
naked mole-rat(101698390) zygote arrest 1-like
domestic guinea pig(100712592) zygote arrest 1-like
83 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001159693 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001159693 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001159693 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001136571 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001136571 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001136571 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001717120 Rosetta Predictions human pricing
XM_929755 Rosetta Predictions human pricing
XM_941036 Rosetta Predictions human pricing
XM_001071298 Rosetta Predictions rat pricing
XM_359419 Rosetta Predictions mouse pricing
XM_622916 Rosetta Predictions mouse pricing
XM_906558 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001717120 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00415108 predicted 786
2 SASI_Hs02_00415109 predicted 826
3 SASI_Hs02_00415110 predicted 792
4 SASI_Hs02_00415111 predicted 714
5 SASI_Hs02_00415112 predicted 732
6 SASI_Hs02_00415113 predicted 709
7 SASI_Hs02_00415114 predicted 670
8 SASI_Hs02_00415115 predicted 809
9 SASI_Hs02_00415116 predicted 239
10 SASI_Hs02_00415117 predicted 732
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_929755 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00272165 predicted 237
2 SASI_Hs02_00481100 predicted 573
3 SASI_Hs01_00272166 predicted 238
4 SASI_Hs01_00272167 predicted 234
5 SASI_Hs01_00272168 predicted 283
6 SASI_Hs02_00481101 predicted 487
7 SASI_Hs01_00272169 predicted 495
8 SASI_Hs01_00272170 predicted 233
9 SASI_Hs02_00481102 predicted 532
10 SASI_Hs01_00272171 predicted 419
11 SASI_Hs01_00272172 predicted 208
12 SASI_Hs01_00272173 predicted 503
13 SASI_Hs01_00272174 predicted 497
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_941036 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00484589 predicted 785
2 SASI_Hs02_00484590 predicted 832
3 SASI_Hs02_00484591 predicted 796
4 SASI_Hs02_00484592 predicted 714
5 SASI_Hs02_00484593 predicted 735
6 SASI_Hs02_00484594 predicted 712
7 SASI_Hs02_00484595 predicted 673
8 SASI_Hs02_00484596 predicted 805
9 SASI_Hs02_00484597 predicted 241
10 SASI_Hs02_00484598 predicted 730
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071298 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00334570 predicted 443
2 SASI_Rn02_00334571 predicted 830
3 SASI_Rn02_00334572 predicted 480
4 SASI_Rn02_00334573 predicted 882
5 SASI_Rn02_00334574 predicted 856
6 SASI_Rn02_00334575 predicted 731
7 SASI_Rn02_00334576 predicted 840
8 SASI_Rn02_00334577 predicted 321
9 SASI_Rn02_00334578 predicted 507
10 SASI_Rn02_00334579 predicted 702
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_359419 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00246091 predicted 194
2 SASI_Mm01_00246092 predicted 482
3 SASI_Mm01_00246093 predicted 489
4 SASI_Mm01_00246094 predicted 466
5 SASI_Mm01_00246095 predicted 493
6 SASI_Mm01_00246096 predicted 474
7 SASI_Mm02_00426349 predicted 298
8 SASI_Mm01_00246097 predicted 293
9 SASI_Mm01_00246098 predicted 469
10 SASI_Mm02_00426350 predicted 268
11 SASI_Mm01_00246099 predicted 276
12 SASI_Mm01_00246100 predicted 330
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_622916 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00428022 predicted 196
2 SASI_Mm02_00428023 predicted 485
3 SASI_Mm02_00428024 predicted 495
4 SASI_Mm02_00428025 predicted 467
5 SASI_Mm02_00428026 predicted 490
6 SASI_Mm02_00428027 predicted 474
7 SASI_Mm02_00428028 predicted 295
8 SASI_Mm02_00428029 predicted 295
9 SASI_Mm02_00428030 predicted 469
10 SASI_Mm02_00428031 predicted 271
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_906558 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00432592 predicted 200
2 SASI_Mm02_00432593 predicted 482
3 SASI_Mm02_00432594 predicted 491
4 SASI_Mm02_00432595 predicted 464
5 SASI_Mm02_00432596 predicted 486
6 SASI_Mm02_00432597 predicted 476
7 SASI_Mm02_00432598 predicted 301
8 SASI_Mm02_00432599 predicted 294
9 SASI_Mm02_00432600 predicted 468
10 SASI_Mm02_00432601 predicted 275
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001159693
ZAR1L MISSION shRNA Bacterial Glycerol Stock
zygote arrest 1-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000347584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159693.1-620s21c1
Sequence:CCGGGGAGATGGGAGAGTGCTTATGCTCGAGCATAAGCACTCTCCCATCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159693.1-464s21c1
Sequence:CCGGGTCAGCTGCTGCTACCTACATCTCGAGATGTAGGTAGCAGCAGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159693.1-598s21c1
Sequence:CCGGTTTCACTGTAAAGATTGTAAGCTCGAGCTTACAATCTTTACAGTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159693.1-706s21c1
Sequence:CCGGTTTAACCCTTACCGAGTAGAACTCGAGTTCTACTCGGTAAGGGTTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159693.1-156s21c1
Sequence:CCGGGTCCTGTATGAACCCTTACAACTCGAGTTGTAAGGGTTCATACAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001159693
ZAR1L MISSION shRNA shRNA Plasmid DNA
zygote arrest 1-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000347584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159693.1-620s21c1
Sequence:CCGGGGAGATGGGAGAGTGCTTATGCTCGAGCATAAGCACTCTCCCATCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159693.1-464s21c1
Sequence:CCGGGTCAGCTGCTGCTACCTACATCTCGAGATGTAGGTAGCAGCAGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159693.1-598s21c1
Sequence:CCGGTTTCACTGTAAAGATTGTAAGCTCGAGCTTACAATCTTTACAGTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159693.1-706s21c1
Sequence:CCGGTTTAACCCTTACCGAGTAGAACTCGAGTTCTACTCGGTAAGGGTTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159693.1-156s21c1
Sequence:CCGGGTCCTGTATGAACCCTTACAACTCGAGTTGTAAGGGTTCATACAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001159693
ZAR1L MISSION shRNA Lentiviral Transduction Particles
zygote arrest 1-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000347584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159693.1-620s21c1
Sequence:CCGGGGAGATGGGAGAGTGCTTATGCTCGAGCATAAGCACTCTCCCATCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159693.1-464s21c1
Sequence:CCGGGTCAGCTGCTGCTACCTACATCTCGAGATGTAGGTAGCAGCAGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159693.1-598s21c1
Sequence:CCGGTTTCACTGTAAAGATTGTAAGCTCGAGCTTACAATCTTTACAGTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159693.1-706s21c1
Sequence:CCGGTTTAACCCTTACCGAGTAGAACTCGAGTTCTACTCGGTAAGGGTTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159693.1-156s21c1
Sequence:CCGGGTCCTGTATGAACCCTTACAACTCGAGTTGTAAGGGTTCATACAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001136571
ZAR1L MISSION shRNA Bacterial Glycerol Stock
zygote arrest 1-like
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136571.1-851s21c1
Sequence:CCGGGACCTGCTCAAAGTCTCATTGCTCGAGCAATGAGACTTTGAGCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136571.1-887s21c1
Sequence:CCGGGAAGAGACACATTGATCTAAGCTCGAGCTTAGATCAATGTGTCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136571.1-761s21c1
Sequence:CCGGTTCTGGAACGAACAAGGTTTACTCGAGTAAACCTTGTTCGTTCCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136571.1-783s21c1
Sequence:CCGGTTCAAACAACTCTGTTGTAAACTCGAGTTTACAACAGAGTTGTTTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136571.1-216s21c1
Sequence:CCGGTACAAGAGGGCGCAGCTTAAGCTCGAGCTTAAGCTGCGCCCTCTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001136571
ZAR1L MISSION shRNA shRNA Plasmid DNA
zygote arrest 1-like
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136571.1-851s21c1
Sequence:CCGGGACCTGCTCAAAGTCTCATTGCTCGAGCAATGAGACTTTGAGCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136571.1-887s21c1
Sequence:CCGGGAAGAGACACATTGATCTAAGCTCGAGCTTAGATCAATGTGTCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136571.1-761s21c1
Sequence:CCGGTTCTGGAACGAACAAGGTTTACTCGAGTAAACCTTGTTCGTTCCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136571.1-783s21c1
Sequence:CCGGTTCAAACAACTCTGTTGTAAACTCGAGTTTACAACAGAGTTGTTTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136571.1-216s21c1
Sequence:CCGGTACAAGAGGGCGCAGCTTAAGCTCGAGCTTAAGCTGCGCCCTCTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001136571
ZAR1L MISSION shRNA Lentiviral Transduction Particles
zygote arrest 1-like
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136571.1-851s21c1
Sequence:CCGGGACCTGCTCAAAGTCTCATTGCTCGAGCAATGAGACTTTGAGCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136571.1-887s21c1
Sequence:CCGGGAAGAGACACATTGATCTAAGCTCGAGCTTAGATCAATGTGTCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136571.1-761s21c1
Sequence:CCGGTTCTGGAACGAACAAGGTTTACTCGAGTAAACCTTGTTCGTTCCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136571.1-783s21c1
Sequence:CCGGTTCAAACAACTCTGTTGTAAACTCGAGTTTACAACAGAGTTGTTTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136571.1-216s21c1
Sequence:CCGGTACAAGAGGGCGCAGCTTAAGCTCGAGCTTAAGCTGCGCCCTCTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks