EMAIL THIS PAGE TO A FRIEND

ZBBX

zinc finger, B-box domain containing

UniProtKB ID: A8MT70, A8MV69, B3KSC1, B5MDJ6, Q9H5T8
Gene ID:
Mouse(213234) zinc finger, B-box domain containing
Rat(361964) zinc finger, B-box domain containing
Zebrafish(100001442) zinc finger, B-box domain containing
dog(478683) zinc finger, B-box domain containing
domestic cat(101100327) zinc finger, B-box domain containing
Horse(100063308) zinc finger, B-box domain containing
naked mole-rat(101722695) zinc finger, B-box domain containing
Domestic Rabbit(100340000) zinc finger, B-box domain containing
cow(617991) zinc finger, B-box domain containing
sheep(101123519) zinc finger, B-box domain containing
79 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024687 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024687 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024687 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172515 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172515 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172515 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024687 Rosetta Predictions human pricing
NM_001029922 Rosetta Predictions rat pricing
NM_172515 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024687 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176461 predicted 2676
2 SASI_Hs01_00176462 predicted 534
3 SASI_Hs02_00357129 predicted 2135
4 SASI_Hs01_00176463 predicted 1100
5 SASI_Hs01_00176465 predicted 1179
6 SASI_Hs01_00176466 predicted 647
7 SASI_Hs01_00176467 predicted 1061
8 SASI_Hs01_00176468 predicted 2401
9 SASI_Hs01_00176469 predicted 2185
10 SASI_Hs02_00357130 predicted 545
11 SASI_Hs01_00176460 predicted 1618
12 SASI_Hs01_00176464 predicted 2531
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029922 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035109 predicted 1479
2 SASI_Rn02_00203493 predicted 276
3 SASI_Rn02_00203494 predicted 920
4 SASI_Rn01_00035111 predicted 1459
5 SASI_Rn01_00035113 predicted 992
6 SASI_Rn01_00035114 predicted 252
7 SASI_Rn01_00035115 predicted 1275
8 SASI_Rn02_00203495 predicted 821
9 SASI_Rn01_00035117 predicted 1523
10 SASI_Rn01_00035118 predicted 374
11 SASI_Rn01_00035110 predicted 1549
12 SASI_Rn01_00035112 predicted 1095
13 SASI_Rn01_00035116 predicted 1124
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172515 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00131599 predicted 1701
2 SASI_Mm01_00131601 predicted 854
3 SASI_Mm01_00131602 predicted 742
4 SASI_Mm01_00131603 predicted 1082
5 SASI_Mm01_00131604 predicted 2185
6 SASI_Mm01_00131605 predicted 799
7 SASI_Mm01_00131606 predicted 1544
8 SASI_Mm01_00131607 predicted 1123
9 SASI_Mm01_00131608 predicted 834
10 SASI_Mm02_00344113 predicted 1746
11 SASI_Mm01_00131600 predicted 1226
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024687
ZBBX MISSION shRNA Bacterial Glycerol Stock
zinc finger, B-box domain containing
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024687.2-499s21c1
Sequence:CCGGATAGAGAGTCAAGCGAGTATTCTCGAGAATACTCGCTTGACTCTCTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024687.2-2158s21c1
Sequence:CCGGATCGTTTAGAATGCAACAATTCTCGAGAATTGTTGCATTCTAAACGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024687.2-1503s21c1
Sequence:CCGGGTCGAACTGGATGATACTTATCTCGAGATAAGTATCATCCAGTTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024687.1-169s1c1
Sequence:CCGGGAACTCCACAAGAGCAACTTTCTCGAGAAAGTTGCTCTTGTGGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024687.1-1231s1c1
Sequence:CCGGCTGTTAAAGAAAGCTCCAGTTCTCGAGAACTGGAGCTTTCTTTAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024687.1-1492s1c1
Sequence:CCGGGCAGCCAATCACTGAATATAACTCGAGTTATATTCAGTGATTGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024687.1-931s1c1
Sequence:CCGGGCAGAAGTAAGCCTATAACAACTCGAGTTGTTATAGGCTTACTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024687.1-1460s1c1
Sequence:CCGGCAGCTTAACCTCAGAAGAGTTCTCGAGAACTCTTCTGAGGTTAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024687
ZBBX MISSION shRNA shRNA Plasmid DNA
zinc finger, B-box domain containing
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024687.2-499s21c1
Sequence:CCGGATAGAGAGTCAAGCGAGTATTCTCGAGAATACTCGCTTGACTCTCTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024687.2-2158s21c1
Sequence:CCGGATCGTTTAGAATGCAACAATTCTCGAGAATTGTTGCATTCTAAACGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024687.2-1503s21c1
Sequence:CCGGGTCGAACTGGATGATACTTATCTCGAGATAAGTATCATCCAGTTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024687.1-169s1c1
Sequence:CCGGGAACTCCACAAGAGCAACTTTCTCGAGAAAGTTGCTCTTGTGGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024687.1-1231s1c1
Sequence:CCGGCTGTTAAAGAAAGCTCCAGTTCTCGAGAACTGGAGCTTTCTTTAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024687.1-1492s1c1
Sequence:CCGGGCAGCCAATCACTGAATATAACTCGAGTTATATTCAGTGATTGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024687.1-931s1c1
Sequence:CCGGGCAGAAGTAAGCCTATAACAACTCGAGTTGTTATAGGCTTACTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024687.1-1460s1c1
Sequence:CCGGCAGCTTAACCTCAGAAGAGTTCTCGAGAACTCTTCTGAGGTTAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024687
ZBBX MISSION shRNA Lentiviral Transduction Particles
zinc finger, B-box domain containing
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024687.2-499s21c1
Sequence:CCGGATAGAGAGTCAAGCGAGTATTCTCGAGAATACTCGCTTGACTCTCTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024687.2-2158s21c1
Sequence:CCGGATCGTTTAGAATGCAACAATTCTCGAGAATTGTTGCATTCTAAACGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024687.2-1503s21c1
Sequence:CCGGGTCGAACTGGATGATACTTATCTCGAGATAAGTATCATCCAGTTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024687.1-169s1c1
Sequence:CCGGGAACTCCACAAGAGCAACTTTCTCGAGAAAGTTGCTCTTGTGGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024687.1-1231s1c1
Sequence:CCGGCTGTTAAAGAAAGCTCCAGTTCTCGAGAACTGGAGCTTTCTTTAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024687.1-1492s1c1
Sequence:CCGGGCAGCCAATCACTGAATATAACTCGAGTTATATTCAGTGATTGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024687.1-931s1c1
Sequence:CCGGGCAGAAGTAAGCCTATAACAACTCGAGTTGTTATAGGCTTACTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024687.1-1460s1c1
Sequence:CCGGCAGCTTAACCTCAGAAGAGTTCTCGAGAACTCTTCTGAGGTTAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172515
ZBBX MISSION shRNA Bacterial Glycerol Stock
zinc finger, B-box domain containing
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215344    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172515.2-1663s1c1
Sequence:CCGGCTTCCCTTCATCAAGCATAAACTCGAGTTTATGCTTGATGAAGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172515.2-1254s1c1
Sequence:CCGGGGTATCACAAGGATGACATAACTCGAGTTATGTCATCCTTGTGATACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172515.2-1136s21c1
Sequence:CCGGAGTTCTACATTTACGGATTATCTCGAGATAATCCGTAAATGTAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172515.2-764s21c1
Sequence:CCGGATGTGGACTGAACCAATTAATCTCGAGATTAATTGGTTCAGTCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172515.2-1254s21c1
Sequence:CCGGGGTATCACAAGGATGACATAACTCGAGTTATGTCATCCTTGTGATACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172515.2-863s21c1
Sequence:CCGGCTTCGTACCATGCTACCAAATCTCGAGATTTGGTAGCATGGTACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172515.2-473s21c1
Sequence:CCGGCCTGCAGAAGCATCGAGTAAACTCGAGTTTACTCGATGCTTCTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172515.1-1031s1c1
Sequence:CCGGCAATAGTAGAACTGGATGATACTCGAGTATCATCCAGTTCTACTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192660    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172515.1-2125s1c1
Sequence:CCGGGAAGAGTTACAGGCATTCAATCTCGAGATTGAATGCCTGTAACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172515
ZBBX MISSION shRNA shRNA Plasmid DNA
zinc finger, B-box domain containing
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215344    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172515.2-1663s1c1
Sequence:CCGGCTTCCCTTCATCAAGCATAAACTCGAGTTTATGCTTGATGAAGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172515.2-1254s1c1
Sequence:CCGGGGTATCACAAGGATGACATAACTCGAGTTATGTCATCCTTGTGATACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172515.2-1136s21c1
Sequence:CCGGAGTTCTACATTTACGGATTATCTCGAGATAATCCGTAAATGTAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172515.2-764s21c1
Sequence:CCGGATGTGGACTGAACCAATTAATCTCGAGATTAATTGGTTCAGTCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172515.2-1254s21c1
Sequence:CCGGGGTATCACAAGGATGACATAACTCGAGTTATGTCATCCTTGTGATACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172515.2-863s21c1
Sequence:CCGGCTTCGTACCATGCTACCAAATCTCGAGATTTGGTAGCATGGTACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172515.2-473s21c1
Sequence:CCGGCCTGCAGAAGCATCGAGTAAACTCGAGTTTACTCGATGCTTCTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172515.1-1031s1c1
Sequence:CCGGCAATAGTAGAACTGGATGATACTCGAGTATCATCCAGTTCTACTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192660    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172515.1-2125s1c1
Sequence:CCGGGAAGAGTTACAGGCATTCAATCTCGAGATTGAATGCCTGTAACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172515
ZBBX MISSION shRNA Lentiviral Transduction Particles
zinc finger, B-box domain containing
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215344    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172515.2-1663s1c1
Sequence:CCGGCTTCCCTTCATCAAGCATAAACTCGAGTTTATGCTTGATGAAGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172515.2-1254s1c1
Sequence:CCGGGGTATCACAAGGATGACATAACTCGAGTTATGTCATCCTTGTGATACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172515.2-1136s21c1
Sequence:CCGGAGTTCTACATTTACGGATTATCTCGAGATAATCCGTAAATGTAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172515.2-764s21c1
Sequence:CCGGATGTGGACTGAACCAATTAATCTCGAGATTAATTGGTTCAGTCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172515.2-1254s21c1
Sequence:CCGGGGTATCACAAGGATGACATAACTCGAGTTATGTCATCCTTGTGATACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172515.2-863s21c1
Sequence:CCGGCTTCGTACCATGCTACCAAATCTCGAGATTTGGTAGCATGGTACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172515.2-473s21c1
Sequence:CCGGCCTGCAGAAGCATCGAGTAAACTCGAGTTTACTCGATGCTTCTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172515.1-1031s1c1
Sequence:CCGGCAATAGTAGAACTGGATGATACTCGAGTATCATCCAGTTCTACTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192660    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172515.1-2125s1c1
Sequence:CCGGGAAGAGTTACAGGCATTCAATCTCGAGATTGAATGCCTGTAACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks