EMAIL THIS PAGE TO A FRIEND

ZBED1

zinc finger, BED-type containing 1

Synonyms: ALTE DREF TRAMP hDREF
UniProtKB ID: O96006, Q96BY4
Gene ID:
Human(9189) Summary: This gene is located in the pseudoautosomal region 1 (PAR1) of X and Y chromosomes. It was earlier identified as a gene with similarity to Ac transposable elements, however, was found not to have transposase activity. Later studies show that this gene product is localized in the nucleus and functions as a transcription factor. It binds to DNA elements found in the promoter regions of several genes related to cell proliferation, such as histone H1, hence may have a role in regulating genes related to cell proliferation. Alternatively spliced transcript variants with different 5' untranslated region have been found for this gene. [provided by RefSeq, Jan 2010]
cow(539266) zinc finger, BED-type containing 1
sheep(101115258) zinc finger, BED-type containing 1
naked mole-rat(101729131) zinc finger, BED-type containing 1
chicken(418663) zinc finger, BED-type containing 1
domestic cat(101101616) zinc finger, BED-type containing 1
dog(491715) zinc finger, BED-type containing 1
26 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004729 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004729 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004729 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU225131 MISSION® esiRNA esiRNA targeting human ZBED1 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004729 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004729 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208233 predicted 1586
2 SASI_Hs01_00208234 predicted 1537
3 SASI_Hs01_00208235 predicted 1922
4 SASI_Hs01_00208236 predicted 897
5 SASI_Hs01_00208237 predicted 786
6 SASI_Hs01_00208238 predicted 1626
7 SASI_Hs01_00208239 predicted 301
8 SASI_Hs02_00338209 predicted 1405
9 SASI_Hs01_00208240 predicted 1782
10 SASI_Hs01_00208241 predicted 420
11 SASI_Hs01_00208242 predicted 981
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004729
VALIDATED
ZBED1 MISSION shRNA Bacterial Glycerol Stock
zinc finger, BED-type containing 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004729.2-548s1c1
Sequence:CCGGCCGGAAGTACATCTCTACCAACTCGAGTTGGTAGAGATGTACTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_004729.2-1035s1c1
Sequence:CCGGGTGGCCATGTACATGCTCTATCTCGAGATAGAGCATGTACATGGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_004729.2-1634s1c1
Sequence:CCGGGCCTCCCGTCAAGAAGCTCATCTCGAGATGAGCTTCTTGACGGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_004729.2-1445s1c1
Sequence:CCGGCGAGATCGACATGTTTCTCAACTCGAGTTGAGAAACATGTCGATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004729.2-119s1c1
Sequence:CCGGCAAGAGCAAGGTGTGGAAGTACTCGAGTACTTCCACACCTTGCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004729.3-1181s21c1
Sequence:CCGGTGGCCATGTACATGCTCTATGCTCGAGCATAGAGCATGTACATGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004729.3-267s21c1
Sequence:CCGGGAGCAAGGTGTGGAAGTATTTCTCGAGAAATACTTCCACACCTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004729.3-359s21c1
Sequence:CCGGAGATCGCCTACTCCGGAAACACTCGAGTGTTTCCGGAGTAGGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234791    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004729.3-4067s21c1
Sequence:CCGGTTACGTCCTGAGCCGGTTTAACTCGAGTTAAACCGGCTCAGGACGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004729.3-2247s21c1
Sequence:CCGGCGGCGGTTTCTTTGGCATTAGCTCGAGCTAATGCCAAAGAAACCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004729
VALIDATED
ZBED1 MISSION shRNA shRNA Plasmid DNA
zinc finger, BED-type containing 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004729.2-548s1c1
Sequence:CCGGCCGGAAGTACATCTCTACCAACTCGAGTTGGTAGAGATGTACTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_004729.2-1035s1c1
Sequence:CCGGGTGGCCATGTACATGCTCTATCTCGAGATAGAGCATGTACATGGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_004729.2-1634s1c1
Sequence:CCGGGCCTCCCGTCAAGAAGCTCATCTCGAGATGAGCTTCTTGACGGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_004729.2-1445s1c1
Sequence:CCGGCGAGATCGACATGTTTCTCAACTCGAGTTGAGAAACATGTCGATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004729.2-119s1c1
Sequence:CCGGCAAGAGCAAGGTGTGGAAGTACTCGAGTACTTCCACACCTTGCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004729.3-1181s21c1
Sequence:CCGGTGGCCATGTACATGCTCTATGCTCGAGCATAGAGCATGTACATGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004729.3-267s21c1
Sequence:CCGGGAGCAAGGTGTGGAAGTATTTCTCGAGAAATACTTCCACACCTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004729.3-359s21c1
Sequence:CCGGAGATCGCCTACTCCGGAAACACTCGAGTGTTTCCGGAGTAGGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234791    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004729.3-4067s21c1
Sequence:CCGGTTACGTCCTGAGCCGGTTTAACTCGAGTTAAACCGGCTCAGGACGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004729.3-2247s21c1
Sequence:CCGGCGGCGGTTTCTTTGGCATTAGCTCGAGCTAATGCCAAAGAAACCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004729
VALIDATED
ZBED1 MISSION shRNA Lentiviral Transduction Particles
zinc finger, BED-type containing 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004729.2-548s1c1
Sequence:CCGGCCGGAAGTACATCTCTACCAACTCGAGTTGGTAGAGATGTACTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_004729.2-1035s1c1
Sequence:CCGGGTGGCCATGTACATGCTCTATCTCGAGATAGAGCATGTACATGGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_004729.2-1634s1c1
Sequence:CCGGGCCTCCCGTCAAGAAGCTCATCTCGAGATGAGCTTCTTGACGGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_004729.2-1445s1c1
Sequence:CCGGCGAGATCGACATGTTTCTCAACTCGAGTTGAGAAACATGTCGATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004729.2-119s1c1
Sequence:CCGGCAAGAGCAAGGTGTGGAAGTACTCGAGTACTTCCACACCTTGCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004729.3-1181s21c1
Sequence:CCGGTGGCCATGTACATGCTCTATGCTCGAGCATAGAGCATGTACATGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004729.3-267s21c1
Sequence:CCGGGAGCAAGGTGTGGAAGTATTTCTCGAGAAATACTTCCACACCTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004729.3-359s21c1
Sequence:CCGGAGATCGCCTACTCCGGAAACACTCGAGTGTTTCCGGAGTAGGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234791    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004729.3-4067s21c1
Sequence:CCGGTTACGTCCTGAGCCGGTTTAACTCGAGTTAAACCGGCTCAGGACGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004729.3-2247s21c1
Sequence:CCGGCGGCGGTTTCTTTGGCATTAGCTCGAGCTAATGCCAAAGAAACCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks