EMAIL THIS PAGE TO A FRIEND

ZBED2

zinc finger, BED-type containing 2

UniProtKB ID: Q9BTP6, D3DN62
Gene ID:
dog(487971) zinc finger, BED-type containing 2
domestic cat(101085824) zinc finger, BED-type containing 2
naked mole-rat(101705069) zinc finger, BED-type containing 2
cow(539880) zinc finger, BED-type containing 2
sheep(101118152) zinc finger, BED-type containing 2
62 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024508 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024508 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024508 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU156331 MISSION® esiRNA esiRNA human ZBED2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024508 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024508 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032160 predicted 1731
2 SASI_Hs01_00032161 predicted 1707
3 SASI_Hs01_00032162 predicted 1692
4 SASI_Hs01_00032163 predicted 1618
5 SASI_Hs01_00032164 predicted 1497
6 SASI_Hs01_00032165 predicted 954
7 SASI_Hs02_00356777 predicted 1165
8 SASI_Hs01_00032166 predicted 1705
9 SASI_Hs01_00032167 predicted 1756
10 SASI_Hs01_00032168 predicted 1602
11 SASI_Hs01_00032159 predicted 1657
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024508
ZBED2 MISSION shRNA Bacterial Glycerol Stock
zinc finger, BED-type containing 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430885    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024508.3-1661s21c1
Sequence:CCGGATAGTGCACAGTATGAGTTAACTCGAGTTAACTCATACTGTGCACTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024508.3-1174s21c1
Sequence:CCGGGCACTGTGGAAGCATCTGAAACTCGAGTTTCAGATGCTTCCACAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420188    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024508.3-1739s21c1
Sequence:CCGGACCCTTGGCCGAAACTCTAAACTCGAGTTTAGAGTTTCGGCCAAGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024508.3-955s21c1
Sequence:CCGGGAGGAGGAAGAGATTAGTGAGCTCGAGCTCACTAATCTCTTCCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179768    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024508.2-541s1c1
Sequence:CCGGGAATATTTCCACCTAGCTCCTCTCGAGAGGAGCTAGGTGGAAATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152607    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024508.2-1168s1c1
Sequence:CCGGGCAGGTCTGAATTGACCAAATCTCGAGATTTGGTCAATTCAGACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150751    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024508.2-1106s1c1
Sequence:CCGGGCAAAGTAGTTTGGTGACATTCTCGAGAATGTCACCAAACTACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151168    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024508.2-1029s1c1
Sequence:CCGGGCTTGGAGAATCTATTCTGAACTCGAGTTCAGAATAGATTCTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024508
ZBED2 MISSION shRNA shRNA Plasmid DNA
zinc finger, BED-type containing 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430885    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024508.3-1661s21c1
Sequence:CCGGATAGTGCACAGTATGAGTTAACTCGAGTTAACTCATACTGTGCACTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024508.3-1174s21c1
Sequence:CCGGGCACTGTGGAAGCATCTGAAACTCGAGTTTCAGATGCTTCCACAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420188    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024508.3-1739s21c1
Sequence:CCGGACCCTTGGCCGAAACTCTAAACTCGAGTTTAGAGTTTCGGCCAAGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024508.3-955s21c1
Sequence:CCGGGAGGAGGAAGAGATTAGTGAGCTCGAGCTCACTAATCTCTTCCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179768    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024508.2-541s1c1
Sequence:CCGGGAATATTTCCACCTAGCTCCTCTCGAGAGGAGCTAGGTGGAAATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152607    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024508.2-1168s1c1
Sequence:CCGGGCAGGTCTGAATTGACCAAATCTCGAGATTTGGTCAATTCAGACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150751    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024508.2-1106s1c1
Sequence:CCGGGCAAAGTAGTTTGGTGACATTCTCGAGAATGTCACCAAACTACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151168    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024508.2-1029s1c1
Sequence:CCGGGCTTGGAGAATCTATTCTGAACTCGAGTTCAGAATAGATTCTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024508
ZBED2 MISSION shRNA Lentiviral Transduction Particles
zinc finger, BED-type containing 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430885    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024508.3-1661s21c1
Sequence:CCGGATAGTGCACAGTATGAGTTAACTCGAGTTAACTCATACTGTGCACTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024508.3-1174s21c1
Sequence:CCGGGCACTGTGGAAGCATCTGAAACTCGAGTTTCAGATGCTTCCACAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420188    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024508.3-1739s21c1
Sequence:CCGGACCCTTGGCCGAAACTCTAAACTCGAGTTTAGAGTTTCGGCCAAGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024508.3-955s21c1
Sequence:CCGGGAGGAGGAAGAGATTAGTGAGCTCGAGCTCACTAATCTCTTCCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179768    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024508.2-541s1c1
Sequence:CCGGGAATATTTCCACCTAGCTCCTCTCGAGAGGAGCTAGGTGGAAATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152607    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024508.2-1168s1c1
Sequence:CCGGGCAGGTCTGAATTGACCAAATCTCGAGATTTGGTCAATTCAGACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150751    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024508.2-1106s1c1
Sequence:CCGGGCAAAGTAGTTTGGTGACATTCTCGAGAATGTCACCAAACTACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151168    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024508.2-1029s1c1
Sequence:CCGGGCTTGGAGAATCTATTCTGAACTCGAGTTCAGAATAGATTCTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks