EMAIL THIS PAGE TO A FRIEND

ZBED3

zinc finger, BED-type containing 3

UniProtKB ID: Q96IU2
Gene ID:
Mouse(72114) zinc finger, BED domain containing 3
Rat(361881) zinc finger, BED-type containing 3
cow(615651) zinc finger, BED-type containing 3
sheep(101107025) zinc finger, BED-type containing 3
naked mole-rat(101711540) zinc finger, BED-type containing 3
domestic guinea pig(100722413) zinc finger, BED-type containing 3
46 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028106 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028106 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028106 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032367 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032367 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032367 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU000641 MISSION® esiRNA esiRNA targeting mouse Zbed3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032367 Rosetta Predictions human pricing
NM_001025729 Rosetta Predictions rat pricing
NM_028106 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032367 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091941 predicted 1039
2 SASI_Hs01_00091943 predicted 910
3 SASI_Hs01_00091944 predicted 971
4 SASI_Hs01_00091945 predicted 1056
5 SASI_Hs01_00091946 predicted 915
6 SASI_Hs02_00359752 predicted 917
7 SASI_Hs01_00091947 predicted 1016
8 SASI_Hs01_00091948 predicted 911
9 SASI_Hs01_00091949 predicted 979
10 SASI_Hs01_00091950 predicted 1097
11 SASI_Hs01_00091942 predicted 993
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025729 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00061886 predicted 1065
2 SASI_Rn01_00061887 predicted 968
3 SASI_Rn01_00061888 predicted 1126
4 SASI_Rn01_00061889 predicted 776
5 SASI_Rn01_00061890 predicted 1051
6 SASI_Rn01_00061891 predicted 1145
7 SASI_Rn01_00061892 predicted 1147
8 SASI_Rn01_00061893 predicted 1052
9 SASI_Rn01_00061894 predicted 962
10 SASI_Rn01_00061895 predicted 640
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028106 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00039485 predicted 1203
2 SASI_Mm01_00039486 predicted 599
3 SASI_Mm01_00039488 predicted 965
4 SASI_Mm01_00039489 predicted 810
5 SASI_Mm02_00333350 predicted 663
6 SASI_Mm01_00039490 predicted 1078
7 SASI_Mm01_00039491 predicted 791
8 SASI_Mm01_00039492 predicted 879
9 SASI_Mm01_00039493 predicted 871
10 SASI_Mm01_00039494 predicted 939
11 SASI_Mm01_00039487 predicted 1139
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028106
VALIDATED
ZBED3 MISSION shRNA Bacterial Glycerol Stock
zinc finger, BED-type containing 3
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182754    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028106.1-1409s1c1
Sequence:CCGGCCTATCTCATTCCCTCCCTTTCTCGAGAAAGGGAGGGAATGAGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028106.1-663s1c1
Sequence:CCGGGAAGCACTGAGTAAGTGGATACTCGAGTATCCACTTACTCAGTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028106.1-671s1c1
Sequence:CCGGGAGTAAGTGGATAAAGAAGCACTCGAGTGCTTCTTTATCCACTTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028106.1-762s1c1
Sequence:CCGGCATGACAACAACAGTGACAATCTCGAGATTGTCACTGTTGTTGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177607    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028106.1-770s1c1
Sequence:CCGGCAACAGTGACAATGATATGGTCTCGAGACCATATCATTGTCACTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198928    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028106.1-775s1c1
Sequence:CCGGGTGACAATGATATGGTCACCACTCGAGTGGTGACCATATCATTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197929    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028106.1-673s1c1
Sequence:CCGGGTAAGTGGATAAAGAAGCAGACTCGAGTCTGCTTCTTTATCCACTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197612    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028106.1-667s1c1
Sequence:CCGGCACTGAGTAAGTGGATAAAGACTCGAGTCTTTATCCACTTACTCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028106.2-663s21c1
Sequence:CCGGGAAGCACTGAGTAAGTGGATACTCGAGTATCCACTTACTCAGTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028106.2-765s21c1
Sequence:CCGGGACAACAACAGTGACAATGATCTCGAGATCATTGTCACTGTTGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219591    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028106.2-1712s1c1
Sequence:CCGGAGGGCAATCTGACCATTATATCTCGAGATATAATGGTCAGATTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028106.2-171s21c1
Sequence:CCGGCTTAATGACCCAGCGGAACAACTCGAGTTGTTCCGCTGGGTCATTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339276    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028106.2-944s21c1
Sequence:CCGGTAAGCCAGAAGGTTCTCTAAACTCGAGTTTAGAGAACCTTCTGGCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028106.2-605s21c1
Sequence:CCGGTCTGAAGCAGGAGGCACAATCCTCGAGGATTGTGCCTCCTGCTTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028106
VALIDATED
ZBED3 MISSION shRNA shRNA Plasmid DNA
zinc finger, BED-type containing 3
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182754    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028106.1-1409s1c1
Sequence:CCGGCCTATCTCATTCCCTCCCTTTCTCGAGAAAGGGAGGGAATGAGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028106.1-663s1c1
Sequence:CCGGGAAGCACTGAGTAAGTGGATACTCGAGTATCCACTTACTCAGTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028106.1-671s1c1
Sequence:CCGGGAGTAAGTGGATAAAGAAGCACTCGAGTGCTTCTTTATCCACTTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028106.1-762s1c1
Sequence:CCGGCATGACAACAACAGTGACAATCTCGAGATTGTCACTGTTGTTGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177607    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028106.1-770s1c1
Sequence:CCGGCAACAGTGACAATGATATGGTCTCGAGACCATATCATTGTCACTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198928    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028106.1-775s1c1
Sequence:CCGGGTGACAATGATATGGTCACCACTCGAGTGGTGACCATATCATTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197929    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028106.1-673s1c1
Sequence:CCGGGTAAGTGGATAAAGAAGCAGACTCGAGTCTGCTTCTTTATCCACTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197612    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028106.1-667s1c1
Sequence:CCGGCACTGAGTAAGTGGATAAAGACTCGAGTCTTTATCCACTTACTCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028106.2-663s21c1
Sequence:CCGGGAAGCACTGAGTAAGTGGATACTCGAGTATCCACTTACTCAGTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028106.2-765s21c1
Sequence:CCGGGACAACAACAGTGACAATGATCTCGAGATCATTGTCACTGTTGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219591    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028106.2-1712s1c1
Sequence:CCGGAGGGCAATCTGACCATTATATCTCGAGATATAATGGTCAGATTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028106.2-171s21c1
Sequence:CCGGCTTAATGACCCAGCGGAACAACTCGAGTTGTTCCGCTGGGTCATTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339276    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028106.2-944s21c1
Sequence:CCGGTAAGCCAGAAGGTTCTCTAAACTCGAGTTTAGAGAACCTTCTGGCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028106.2-605s21c1
Sequence:CCGGTCTGAAGCAGGAGGCACAATCCTCGAGGATTGTGCCTCCTGCTTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028106
VALIDATED
ZBED3 MISSION shRNA Lentiviral Transduction Particles
zinc finger, BED-type containing 3
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182754    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028106.1-1409s1c1
Sequence:CCGGCCTATCTCATTCCCTCCCTTTCTCGAGAAAGGGAGGGAATGAGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028106.1-663s1c1
Sequence:CCGGGAAGCACTGAGTAAGTGGATACTCGAGTATCCACTTACTCAGTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028106.1-671s1c1
Sequence:CCGGGAGTAAGTGGATAAAGAAGCACTCGAGTGCTTCTTTATCCACTTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028106.1-762s1c1
Sequence:CCGGCATGACAACAACAGTGACAATCTCGAGATTGTCACTGTTGTTGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177607    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028106.1-770s1c1
Sequence:CCGGCAACAGTGACAATGATATGGTCTCGAGACCATATCATTGTCACTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198928    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028106.1-775s1c1
Sequence:CCGGGTGACAATGATATGGTCACCACTCGAGTGGTGACCATATCATTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197929    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028106.1-673s1c1
Sequence:CCGGGTAAGTGGATAAAGAAGCAGACTCGAGTCTGCTTCTTTATCCACTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197612    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028106.1-667s1c1
Sequence:CCGGCACTGAGTAAGTGGATAAAGACTCGAGTCTTTATCCACTTACTCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028106.2-663s21c1
Sequence:CCGGGAAGCACTGAGTAAGTGGATACTCGAGTATCCACTTACTCAGTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028106.2-765s21c1
Sequence:CCGGGACAACAACAGTGACAATGATCTCGAGATCATTGTCACTGTTGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219591    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028106.2-1712s1c1
Sequence:CCGGAGGGCAATCTGACCATTATATCTCGAGATATAATGGTCAGATTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028106.2-171s21c1
Sequence:CCGGCTTAATGACCCAGCGGAACAACTCGAGTTGTTCCGCTGGGTCATTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339276    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028106.2-944s21c1
Sequence:CCGGTAAGCCAGAAGGTTCTCTAAACTCGAGTTTAGAGAACCTTCTGGCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028106.2-605s21c1
Sequence:CCGGTCTGAAGCAGGAGGCACAATCCTCGAGGATTGTGCCTCCTGCTTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032367
ZBED3 MISSION shRNA Bacterial Glycerol Stock
zinc finger, BED-type containing 3
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000243182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032367.2-1067s21c1
Sequence:CCGGCGGAAGCTCCAGCTAACTGTACTCGAGTACAGTTAGCTGGAGCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032367.2-1101s21c1
Sequence:CCGGCCTAAGGCTTCAGCTTGAGAACTCGAGTTCTCAAGCTGAAGCCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243184    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032367.2-1128s21c1
Sequence:CCGGCGAAGCCAGAGCAGAACCAAACTCGAGTTTGGTTCTGCTCTGGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032367.2-920s21c1
Sequence:CCGGGACGGCTGCGTCATCACAAAGCTCGAGCTTTGTGATGACGCAGCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032367
ZBED3 MISSION shRNA shRNA Plasmid DNA
zinc finger, BED-type containing 3
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000243182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032367.2-1067s21c1
Sequence:CCGGCGGAAGCTCCAGCTAACTGTACTCGAGTACAGTTAGCTGGAGCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032367.2-1101s21c1
Sequence:CCGGCCTAAGGCTTCAGCTTGAGAACTCGAGTTCTCAAGCTGAAGCCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243184    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032367.2-1128s21c1
Sequence:CCGGCGAAGCCAGAGCAGAACCAAACTCGAGTTTGGTTCTGCTCTGGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032367.2-920s21c1
Sequence:CCGGGACGGCTGCGTCATCACAAAGCTCGAGCTTTGTGATGACGCAGCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032367
ZBED3 MISSION shRNA Lentiviral Transduction Particles
zinc finger, BED-type containing 3
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000243182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032367.2-1067s21c1
Sequence:CCGGCGGAAGCTCCAGCTAACTGTACTCGAGTACAGTTAGCTGGAGCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032367.2-1101s21c1
Sequence:CCGGCCTAAGGCTTCAGCTTGAGAACTCGAGTTCTCAAGCTGAAGCCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243184    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032367.2-1128s21c1
Sequence:CCGGCGAAGCCAGAGCAGAACCAAACTCGAGTTTGGTTCTGCTCTGGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032367.2-920s21c1
Sequence:CCGGGACGGCTGCGTCATCACAAAGCTCGAGCTTTGTGATGACGCAGCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks