EMAIL THIS PAGE TO A FRIEND

ZBED4

zinc finger, BED-type containing 4

UniProtKB ID: O75132, B2RZH1, Q1ECU0, Q9UGG8
Gene ID:
Mouse(223773) zinc finger, BED domain containing 4
Rat(315211) zinc finger, BED-type containing 4
Zebrafish(100000808) zinc finger, BED domain containing 4
domestic cat(101098554) zinc finger, BED-type containing 4
Horse(100054656) zinc finger, BED-type containing 4
chicken(417734) zinc finger, BED-type containing 4
dog(481197) zinc finger, BED-type containing 4
domestic guinea pig(100722581) zinc finger, BED-type containing 4
naked mole-rat(101716234) zinc finger, BED-type containing 4
cow(100852266) zinc finger, BED-type containing 4
sheep(101112641) zinc finger, BED-type containing 4
cow(100300303) zinc finger, BED-type containing 4
66 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181412 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181412 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181412 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014838 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014838 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014838 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014838 Rosetta Predictions human pricing
NM_001134800 Rosetta Predictions rat pricing
NM_181412 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014838 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026911 predicted 1382
2 SASI_Hs01_00026912 predicted 1170
3 SASI_Hs01_00026913 predicted 2509
4 SASI_Hs01_00026914 predicted 3533
5 SASI_Hs02_00346395 predicted 3657
6 SASI_Hs01_00026916 predicted 3944
7 SASI_Hs01_00026917 predicted 905
8 SASI_Hs01_00026919 predicted 3845
9 SASI_Hs02_00346396 predicted 1588
10 SASI_Hs01_00026920 predicted 558
11 SASI_Hs01_00026915 predicted 1071
12 SASI_Hs01_00026918 predicted 3168
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134800 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258584 predicted 591
2 SASI_Rn02_00258585 predicted 2778
3 SASI_Rn02_00258586 predicted 876
4 SASI_Rn02_00258587 predicted 3035
5 SASI_Rn02_00258588 predicted 1497
6 SASI_Rn02_00258589 predicted 540
7 SASI_Rn02_00258590 predicted 1597
8 SASI_Rn02_00258591 predicted 1680
9 SASI_Rn02_00258592 predicted 3829
10 SASI_Rn02_00258593 predicted 843
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181412 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349761 predicted 3648
2 SASI_Mm02_00349762 predicted 2590
3 SASI_Mm02_00349763 predicted 670
4 SASI_Mm02_00349764 predicted 2872
5 SASI_Mm02_00349765 predicted 2712
6 SASI_Mm02_00349766 predicted 2616
7 SASI_Mm02_00349767 predicted 4135
8 SASI_Mm02_00349768 predicted 1041
9 SASI_Mm02_00349769 predicted 1367
10 SASI_Mm02_00349770 predicted 3236
11 SASI_Mm01_00069390 predicted 2808
12 SASI_Mm01_00069391 predicted 749
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181412
VALIDATED
ZBED4 MISSION shRNA Bacterial Glycerol Stock
zinc finger, BED-type containing 4
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241721    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_181412.3-4669s21c1
Sequence:CCGGTGTCAATCACATGGCTAATTGCTCGAGCAATTAGCCATGTGATTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241725    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181412.3-5071s21c1
Sequence:CCGGCAACCATCACTGGGACATTATCTCGAGATAATGTCCCAGTGATGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241722    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181412.3-4821s21c1
Sequence:CCGGGAGCATGATATGACACGTTTACTCGAGTAAACGTGTCATATCATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241724    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_181412.3-5118s21c1
Sequence:CCGGTATCAGCTATCAGACTCTTTACTCGAGTAAAGAGTCTGATAGCTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241723    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_181412.3-4952s21c1
Sequence:CCGGTAGCGCTCAGATTCTACTTTGCTCGAGCAAAGTAGAATCTGAGCGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192713    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181412.2-4901s1c1
Sequence:CCGGGCGCTTGTTTATTGCAGTCATCTCGAGATGACTGCAATAAACAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191868    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181412.2-4410s1c1
Sequence:CCGGGCTGTTAAATGAAACCTGTAACTCGAGTTACAGGTTTCATTTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181412
VALIDATED
ZBED4 MISSION shRNA shRNA Plasmid DNA
zinc finger, BED-type containing 4
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241721    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_181412.3-4669s21c1
Sequence:CCGGTGTCAATCACATGGCTAATTGCTCGAGCAATTAGCCATGTGATTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241725    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181412.3-5071s21c1
Sequence:CCGGCAACCATCACTGGGACATTATCTCGAGATAATGTCCCAGTGATGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241722    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181412.3-4821s21c1
Sequence:CCGGGAGCATGATATGACACGTTTACTCGAGTAAACGTGTCATATCATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241724    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_181412.3-5118s21c1
Sequence:CCGGTATCAGCTATCAGACTCTTTACTCGAGTAAAGAGTCTGATAGCTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241723    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_181412.3-4952s21c1
Sequence:CCGGTAGCGCTCAGATTCTACTTTGCTCGAGCAAAGTAGAATCTGAGCGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192713    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181412.2-4901s1c1
Sequence:CCGGGCGCTTGTTTATTGCAGTCATCTCGAGATGACTGCAATAAACAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191868    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181412.2-4410s1c1
Sequence:CCGGGCTGTTAAATGAAACCTGTAACTCGAGTTACAGGTTTCATTTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181412
VALIDATED
ZBED4 MISSION shRNA Lentiviral Transduction Particles
zinc finger, BED-type containing 4
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241721    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_181412.3-4669s21c1
Sequence:CCGGTGTCAATCACATGGCTAATTGCTCGAGCAATTAGCCATGTGATTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241725    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181412.3-5071s21c1
Sequence:CCGGCAACCATCACTGGGACATTATCTCGAGATAATGTCCCAGTGATGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241722    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181412.3-4821s21c1
Sequence:CCGGGAGCATGATATGACACGTTTACTCGAGTAAACGTGTCATATCATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241724    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_181412.3-5118s21c1
Sequence:CCGGTATCAGCTATCAGACTCTTTACTCGAGTAAAGAGTCTGATAGCTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241723    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_181412.3-4952s21c1
Sequence:CCGGTAGCGCTCAGATTCTACTTTGCTCGAGCAAAGTAGAATCTGAGCGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192713    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181412.2-4901s1c1
Sequence:CCGGGCGCTTGTTTATTGCAGTCATCTCGAGATGACTGCAATAAACAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191868    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181412.2-4410s1c1
Sequence:CCGGGCTGTTAAATGAAACCTGTAACTCGAGTTACAGGTTTCATTTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014838
VALIDATED
ZBED4 MISSION shRNA Bacterial Glycerol Stock
zinc finger, BED-type containing 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163125    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014838.1-2333s1c1
Sequence:CCGGGCACAGAATTATCAGGCGCTTCTCGAGAAGCGCCTGATAATTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014838.1-2473s1c1
Sequence:CCGGGTTGGCTTTAACAGGCTGCTTCTCGAGAAGCAGCCTGTTAAAGCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162734    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014838.1-2045s1c1
Sequence:CCGGCCAAATTGACTGACTTGCCAACTCGAGTTGGCAAGTCAGTCAATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161694    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014838.1-4767s1c1
Sequence:CCGGGCTCTGAAGCTGTCTTTCAAACTCGAGTTTGAAAGACAGCTTCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160131    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014838.1-474s1c1
Sequence:CCGGCGGTGATTTCGTTTCTGATAACTCGAGTTATCAGAAACGAAATCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159159    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014838.1-3507s1c1
Sequence:CCGGGCAGTACAAACAGGATTTAATCTCGAGATTAAATCCTGTTTGTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158934    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014838.1-4866s1c1
Sequence:CCGGGCTTGTTATATTCCAGTTGTACTCGAGTACAACTGGAATATAACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162038    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014838.1-4650s1c1
Sequence:CCGGCCTCTGAAATGTGATCCCTTTCTCGAGAAAGGGATCACATTTCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014838
VALIDATED
ZBED4 MISSION shRNA shRNA Plasmid DNA
zinc finger, BED-type containing 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163125    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014838.1-2333s1c1
Sequence:CCGGGCACAGAATTATCAGGCGCTTCTCGAGAAGCGCCTGATAATTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014838.1-2473s1c1
Sequence:CCGGGTTGGCTTTAACAGGCTGCTTCTCGAGAAGCAGCCTGTTAAAGCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162734    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014838.1-2045s1c1
Sequence:CCGGCCAAATTGACTGACTTGCCAACTCGAGTTGGCAAGTCAGTCAATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161694    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014838.1-4767s1c1
Sequence:CCGGGCTCTGAAGCTGTCTTTCAAACTCGAGTTTGAAAGACAGCTTCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160131    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014838.1-474s1c1
Sequence:CCGGCGGTGATTTCGTTTCTGATAACTCGAGTTATCAGAAACGAAATCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159159    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014838.1-3507s1c1
Sequence:CCGGGCAGTACAAACAGGATTTAATCTCGAGATTAAATCCTGTTTGTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158934    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014838.1-4866s1c1
Sequence:CCGGGCTTGTTATATTCCAGTTGTACTCGAGTACAACTGGAATATAACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162038    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014838.1-4650s1c1
Sequence:CCGGCCTCTGAAATGTGATCCCTTTCTCGAGAAAGGGATCACATTTCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014838
VALIDATED
ZBED4 MISSION shRNA Lentiviral Transduction Particles
zinc finger, BED-type containing 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163125    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014838.1-2333s1c1
Sequence:CCGGGCACAGAATTATCAGGCGCTTCTCGAGAAGCGCCTGATAATTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014838.1-2473s1c1
Sequence:CCGGGTTGGCTTTAACAGGCTGCTTCTCGAGAAGCAGCCTGTTAAAGCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162734    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014838.1-2045s1c1
Sequence:CCGGCCAAATTGACTGACTTGCCAACTCGAGTTGGCAAGTCAGTCAATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161694    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014838.1-4767s1c1
Sequence:CCGGGCTCTGAAGCTGTCTTTCAAACTCGAGTTTGAAAGACAGCTTCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160131    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014838.1-474s1c1
Sequence:CCGGCGGTGATTTCGTTTCTGATAACTCGAGTTATCAGAAACGAAATCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159159    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014838.1-3507s1c1
Sequence:CCGGGCAGTACAAACAGGATTTAATCTCGAGATTAAATCCTGTTTGTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158934    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014838.1-4866s1c1
Sequence:CCGGGCTTGTTATATTCCAGTTGTACTCGAGTACAACTGGAATATAACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162038    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014838.1-4650s1c1
Sequence:CCGGCCTCTGAAATGTGATCCCTTTCTCGAGAAAGGGATCACATTTCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks