EMAIL THIS PAGE TO A FRIEND

ZBED5

zinc finger, BED-type containing 5

Synonyms: Buster1
UniProtKB ID: Q49AG3, B2RCC1, Q05D82, Q86WW3, Q9NT24, Q9UBJ4
Gene ID:
Human(58486) Summary: This gene is unusual in that its coding sequence is mostly derived from Charlie-like DNA transposon; however, it does not appear to be an active DNA transposon as it is not flanked by terminal inverted repeats. The encoded protein is conserved among the mammalian Laurasiatheria branch. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jan 2009]
Rat(288622) zinc finger, BED-type containing 5
cow(539898) zinc finger, BED-type containing 5
sheep(101122975) zinc finger, BED-type containing 5
naked mole-rat(101709519) zinc finger, BED-type containing 5
dog(612956) zinc finger, BED-type containing 5
domestic cat(101089715) zinc finger, BED-type containing 5
69 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021211 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021211 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021211 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021211 Rosetta Predictions human pricing
XR_041298 Rosetta Predictions human pricing
XR_041299 Rosetta Predictions human pricing
XR_041300 Rosetta Predictions human pricing
NM_001105924 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021211 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116460 predicted 524
2 SASI_Hs01_00116461 predicted 529
3 SASI_Hs01_00116462 predicted 542
4 SASI_Hs01_00116463 predicted 544
5 SASI_Hs01_00116464 predicted 547
6 SASI_Hs01_00116465 predicted 551
7 SASI_Hs01_00116466 predicted 509
8 SASI_Hs01_00116467 predicted 551
9 SASI_Hs01_00116468 predicted 544
10 SASI_Hs01_00116469 predicted 553
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041298 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00526224 predicted 396
2 SASI_Hs02_00526225 predicted 540
3 SASI_Hs02_00526226 predicted 374
4 SASI_Hs02_00526227 predicted 422
5 SASI_Hs02_00526228 predicted 437
6 SASI_Hs02_00526229 predicted 539
7 SASI_Hs02_00526230 predicted 413
8 SASI_Hs02_00526231 predicted 467
9 SASI_Hs02_00526232 predicted 378
10 SASI_Hs02_00526233 predicted 459
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041299 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00526234 predicted 397
2 SASI_Hs02_00526235 predicted 539
3 SASI_Hs02_00526236 predicted 374
4 SASI_Hs02_00526237 predicted 422
5 SASI_Hs02_00526238 predicted 430
6 SASI_Hs02_00526239 predicted 536
7 SASI_Hs02_00526240 predicted 412
8 SASI_Hs02_00526241 predicted 460
9 SASI_Hs02_00526242 predicted 381
10 SASI_Hs02_00526243 predicted 464
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041300 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00526244 predicted 393
2 SASI_Hs02_00526245 predicted 541
3 SASI_Hs02_00526246 predicted 375
4 SASI_Hs02_00526247 predicted 421
5 SASI_Hs02_00526248 predicted 431
6 SASI_Hs02_00526249 predicted 535
7 SASI_Hs02_00526250 predicted 413
8 SASI_Hs02_00526251 predicted 459
9 SASI_Hs02_00526252 predicted 376
10 SASI_Hs02_00526253 predicted 460
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105924 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213882 predicted 1135
2 SASI_Rn02_00213883 predicted 1200
3 SASI_Rn02_00213884 predicted 1417
4 SASI_Rn02_00213885 predicted 1125
5 SASI_Rn02_00213886 predicted 1817
6 SASI_Rn02_00213887 predicted 2251
7 SASI_Rn02_00213888 predicted 1023
8 SASI_Rn02_00213889 predicted 679
9 SASI_Rn02_00213890 predicted 735
10 SASI_Rn02_00213891 predicted 1104
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021211
VALIDATED
ZBED5 MISSION shRNA Bacterial Glycerol Stock
zinc finger, BED-type containing 5
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021211.1-1528s1c1
Sequence:CCGGGCCGAAGCTGTCACCTTAATACTCGAGTATTAAGGTGACAGCTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_021211.1-1049s1c1
Sequence:CCGGCAGAAGCATCATACAATGTAACTCGAGTTACATTGTATGATGCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_021211.1-518s1c1
Sequence:CCGGCGATACTCAATGTCTATTCTACTCGAGTAGAATAGACATTGAGTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021211.1-1116s1c1
Sequence:CCGGGCTTATCAAACCTTGTGCAAACTCGAGTTTGCACAAGGTTTGATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021211.1-916s1c1
Sequence:CCGGCGAAGACATTTGGAAACTAAACTCGAGTTTAGTTTCCAAATGTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021211.1-2473s1c1
Sequence:CCGGCGAATCCGACTTAGCAATATTCTCGAGAATATTGCTAAGTCGGATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_021211.1-2319s1c1
Sequence:CCGGGAGTAGCCTAATTCAGGAATACTCGAGTATTCCTGAATTAGGCTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021211.1-599s1c1
Sequence:CCGGGTCTTAAACAAGAAGTGGAATCTCGAGATTCCACTTCTTGTTTAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021211.1-1647s1c1
Sequence:CCGGCCAGGCAGTACAAATCATCAACTCGAGTTGATGATTTGTACTGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021211.3-1559s21c1
Sequence:CCGGGCCGAAGCTGTCACCTTAATACTCGAGTATTAAGGTGACAGCTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_021211.3-2504s21c1
Sequence:CCGGCGAATCCGACTTAGCAATATTCTCGAGAATATTGCTAAGTCGGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_021211.3-1237s21c1
Sequence:CCGGTACTGTTGCACGTCGAATTAACTCGAGTTAATTCGACGTGCAACAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_021211.3-2350s21c1
Sequence:CCGGGAGTAGCCTAATTCAGGAATACTCGAGTATTCCTGAATTAGGCTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021211
VALIDATED
ZBED5 MISSION shRNA shRNA Plasmid DNA
zinc finger, BED-type containing 5
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021211.1-1528s1c1
Sequence:CCGGGCCGAAGCTGTCACCTTAATACTCGAGTATTAAGGTGACAGCTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_021211.1-1049s1c1
Sequence:CCGGCAGAAGCATCATACAATGTAACTCGAGTTACATTGTATGATGCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_021211.1-518s1c1
Sequence:CCGGCGATACTCAATGTCTATTCTACTCGAGTAGAATAGACATTGAGTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021211.1-1116s1c1
Sequence:CCGGGCTTATCAAACCTTGTGCAAACTCGAGTTTGCACAAGGTTTGATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021211.1-916s1c1
Sequence:CCGGCGAAGACATTTGGAAACTAAACTCGAGTTTAGTTTCCAAATGTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021211.1-2473s1c1
Sequence:CCGGCGAATCCGACTTAGCAATATTCTCGAGAATATTGCTAAGTCGGATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_021211.1-2319s1c1
Sequence:CCGGGAGTAGCCTAATTCAGGAATACTCGAGTATTCCTGAATTAGGCTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021211.1-599s1c1
Sequence:CCGGGTCTTAAACAAGAAGTGGAATCTCGAGATTCCACTTCTTGTTTAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021211.1-1647s1c1
Sequence:CCGGCCAGGCAGTACAAATCATCAACTCGAGTTGATGATTTGTACTGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021211.3-1559s21c1
Sequence:CCGGGCCGAAGCTGTCACCTTAATACTCGAGTATTAAGGTGACAGCTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_021211.3-2504s21c1
Sequence:CCGGCGAATCCGACTTAGCAATATTCTCGAGAATATTGCTAAGTCGGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_021211.3-1237s21c1
Sequence:CCGGTACTGTTGCACGTCGAATTAACTCGAGTTAATTCGACGTGCAACAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_021211.3-2350s21c1
Sequence:CCGGGAGTAGCCTAATTCAGGAATACTCGAGTATTCCTGAATTAGGCTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021211
VALIDATED
ZBED5 MISSION shRNA Lentiviral Transduction Particles
zinc finger, BED-type containing 5
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021211.1-1528s1c1
Sequence:CCGGGCCGAAGCTGTCACCTTAATACTCGAGTATTAAGGTGACAGCTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_021211.1-1049s1c1
Sequence:CCGGCAGAAGCATCATACAATGTAACTCGAGTTACATTGTATGATGCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_021211.1-518s1c1
Sequence:CCGGCGATACTCAATGTCTATTCTACTCGAGTAGAATAGACATTGAGTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021211.1-1116s1c1
Sequence:CCGGGCTTATCAAACCTTGTGCAAACTCGAGTTTGCACAAGGTTTGATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021211.1-916s1c1
Sequence:CCGGCGAAGACATTTGGAAACTAAACTCGAGTTTAGTTTCCAAATGTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021211.1-2473s1c1
Sequence:CCGGCGAATCCGACTTAGCAATATTCTCGAGAATATTGCTAAGTCGGATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_021211.1-2319s1c1
Sequence:CCGGGAGTAGCCTAATTCAGGAATACTCGAGTATTCCTGAATTAGGCTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021211.1-599s1c1
Sequence:CCGGGTCTTAAACAAGAAGTGGAATCTCGAGATTCCACTTCTTGTTTAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021211.1-1647s1c1
Sequence:CCGGCCAGGCAGTACAAATCATCAACTCGAGTTGATGATTTGTACTGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021211.3-1559s21c1
Sequence:CCGGGCCGAAGCTGTCACCTTAATACTCGAGTATTAAGGTGACAGCTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_021211.3-2504s21c1
Sequence:CCGGCGAATCCGACTTAGCAATATTCTCGAGAATATTGCTAAGTCGGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_021211.3-1237s21c1
Sequence:CCGGTACTGTTGCACGTCGAATTAACTCGAGTTAATTCGACGTGCAACAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_021211.3-2350s21c1
Sequence:CCGGGAGTAGCCTAATTCAGGAATACTCGAGTATTCCTGAATTAGGCTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks