EMAIL THIS PAGE TO A FRIEND

ZBED6CL

ZBED6 C-terminal like

Synonyms: C7orf29
Species: Human ZBED6CL(113763), naked mole-rat Zbed6cl(101727318), domestic guinea pig Zbed6cl(100731465)
UniProtKB ID: Q96FA7
Gene ID:
naked mole-rat(101727318) ZBED6 C-terminal like
domestic guinea pig(100731465) ZBED6 C-terminal like
32 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138434 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138434 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138434 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU008531 MISSION® esiRNA esiRNA targeting human C7orf29 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138434 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138434 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126995 predicted 883
2 SASI_Hs01_00126996 predicted 880
3 SASI_Hs01_00126997 predicted 848
4 SASI_Hs02_00363589 predicted 859
5 SASI_Hs02_00363590 predicted 748
6 SASI_Hs02_00363591 predicted 1186
7 SASI_Hs02_00363592 predicted 1325
8 SASI_Hs01_00126998 predicted 834
9 SASI_Hs01_00126999 predicted 754
10 SASI_Hs01_00127002 predicted 1219
11 SASI_Hs01_00127000 predicted 841
12 SASI_Hs01_00127001 predicted 1330
13 SASI_Hs01_00127003 predicted 626
14 SASI_Hs01_00127004 predicted 1212
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138434
ZBED6CL MISSION shRNA Bacterial Glycerol Stock
ZBED6 C-terminal like
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430986    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138434.2-1613s21c1
Sequence:CCGGAGTTTCTCACTTGACAGATTGCTCGAGCAATCTGTCAAGTGAGAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138434.2-1225s21c1
Sequence:CCGGGCCACCATCTATCTGTCTTACCTCGAGGTAAGACAGATAGATGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138434.2-889s21c1
Sequence:CCGGAGTGTCTGAATACTCTTTGAACTCGAGTTCAAAGAGTATTCAGACACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429669    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138434.2-1571s21c1
Sequence:CCGGGCTCATGGCCAGAATCTTAAACTCGAGTTTAAGATTCTGGCCATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428573    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138434.2-1690s21c1
Sequence:CCGGTCTAGCAGTATGTGCCGAGAACTCGAGTTCTCGGCACATACTGCTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168335    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138434.1-684s1c1
Sequence:CCGGGAAGTATCTGTGGGAGAATGACTCGAGTCATTCTCCCACAGATACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168184    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138434.1-681s1c1
Sequence:CCGGCAAGAAGTATCTGTGGGAGAACTCGAGTTCTCCCACAGATACTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172615    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138434.1-390s1c1
Sequence:CCGGGAAGCAAGTCCTCGTGTACAACTCGAGTTGTACACGAGGACTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172394    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138434.1-274s1c1
Sequence:CCGGCAGCTCAACAAGCTCTTCTACCTCGAGGTAGAAGAGCTTGTTGAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138434
ZBED6CL MISSION shRNA shRNA Plasmid DNA
ZBED6 C-terminal like
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430986    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138434.2-1613s21c1
Sequence:CCGGAGTTTCTCACTTGACAGATTGCTCGAGCAATCTGTCAAGTGAGAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138434.2-1225s21c1
Sequence:CCGGGCCACCATCTATCTGTCTTACCTCGAGGTAAGACAGATAGATGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138434.2-889s21c1
Sequence:CCGGAGTGTCTGAATACTCTTTGAACTCGAGTTCAAAGAGTATTCAGACACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429669    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138434.2-1571s21c1
Sequence:CCGGGCTCATGGCCAGAATCTTAAACTCGAGTTTAAGATTCTGGCCATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428573    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138434.2-1690s21c1
Sequence:CCGGTCTAGCAGTATGTGCCGAGAACTCGAGTTCTCGGCACATACTGCTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168335    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138434.1-684s1c1
Sequence:CCGGGAAGTATCTGTGGGAGAATGACTCGAGTCATTCTCCCACAGATACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168184    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138434.1-681s1c1
Sequence:CCGGCAAGAAGTATCTGTGGGAGAACTCGAGTTCTCCCACAGATACTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172615    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138434.1-390s1c1
Sequence:CCGGGAAGCAAGTCCTCGTGTACAACTCGAGTTGTACACGAGGACTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172394    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138434.1-274s1c1
Sequence:CCGGCAGCTCAACAAGCTCTTCTACCTCGAGGTAGAAGAGCTTGTTGAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138434
ZBED6CL MISSION shRNA Lentiviral Transduction Particles
ZBED6 C-terminal like
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430986    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138434.2-1613s21c1
Sequence:CCGGAGTTTCTCACTTGACAGATTGCTCGAGCAATCTGTCAAGTGAGAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138434.2-1225s21c1
Sequence:CCGGGCCACCATCTATCTGTCTTACCTCGAGGTAAGACAGATAGATGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138434.2-889s21c1
Sequence:CCGGAGTGTCTGAATACTCTTTGAACTCGAGTTCAAAGAGTATTCAGACACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429669    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138434.2-1571s21c1
Sequence:CCGGGCTCATGGCCAGAATCTTAAACTCGAGTTTAAGATTCTGGCCATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428573    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138434.2-1690s21c1
Sequence:CCGGTCTAGCAGTATGTGCCGAGAACTCGAGTTCTCGGCACATACTGCTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168335    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138434.1-684s1c1
Sequence:CCGGGAAGTATCTGTGGGAGAATGACTCGAGTCATTCTCCCACAGATACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168184    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138434.1-681s1c1
Sequence:CCGGCAAGAAGTATCTGTGGGAGAACTCGAGTTCTCCCACAGATACTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172615    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138434.1-390s1c1
Sequence:CCGGGAAGCAAGTCCTCGTGTACAACTCGAGTTGTACACGAGGACTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172394    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138434.1-274s1c1
Sequence:CCGGCAGCTCAACAAGCTCTTCTACCTCGAGGTAGAAGAGCTTGTTGAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks