EMAIL THIS PAGE TO A FRIEND

ZBP1

Z-DNA binding protein 1

Synonyms: C20orf183 DAI DLM-1 DLM1
UniProtKB ID: Q9H171, A2A2F7, B3KVA1, F5GYT1, Q5JY39, Q9BYW4
Gene ID:
Human(81030) Summary: This gene encodes a Z-DNA binding protein. The encoded protein plays a role in the innate immune response by binding to foreign DNA and inducing type-I interferon production. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Mouse(58203) Z-DNA binding protein 1
Rat(171091) Z-DNA binding protein 1
cow(508333) Z-DNA binding protein 1
sheep(101104169) Z-DNA binding protein 1
domestic guinea pig(100734114) Z-DNA binding protein 1
dog(611825) Z-DNA binding protein 1
domestic cat(101093425) Z-DNA binding protein 1
54 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021394 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021394 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021394 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_030776 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030776 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030776 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030776 Rosetta Predictions human pricing
XM_001054526 Rosetta Predictions rat pricing
XM_342594 Rosetta Predictions rat pricing
NM_021394 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030776 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240112 predicted 507
2 SASI_Hs01_00240113 predicted 727
3 SASI_Hs01_00240114 predicted 703
4 SASI_Hs01_00240116 predicted 1290
5 SASI_Hs01_00240117 predicted 801
6 SASI_Hs01_00240118 predicted 1457
7 SASI_Hs01_00240119 predicted 304
8 SASI_Hs01_00240120 predicted 1408
9 SASI_Hs01_00240121 predicted 981
10 SASI_Hs02_00358318 predicted 1311
11 SASI_Hs01_00240115 predicted 701
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054526 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00276129 predicted 1160
2 SASI_Rn02_00276130 predicted 457
3 SASI_Rn02_00276131 predicted 912
4 SASI_Rn02_00276132 predicted 707
5 SASI_Rn02_00276133 predicted 927
6 SASI_Rn02_00276134 predicted 409
7 SASI_Rn02_00276135 predicted 1319
8 SASI_Rn02_00276136 predicted 371
9 SASI_Rn02_00276137 predicted 919
10 SASI_Rn02_00276138 predicted 852
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342594 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00150983 predicted 706
2 SASI_Rn01_00150984 predicted 1323
3 SASI_Rn01_00150985 predicted 464
4 SASI_Rn01_00150986 predicted 338
5 SASI_Rn01_00150987 predicted 583
6 SASI_Rn01_00150988 predicted 652
7 SASI_Rn01_00150989 predicted 709
8 SASI_Rn01_00150990 predicted 409
9 SASI_Rn01_00150991 predicted 1316
10 SASI_Rn02_00394529 predicted 371
11 SASI_Rn01_00150992 predicted 774
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021394 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00082660 predicted 375
2 SASI_Mm01_00082661 predicted 1274
3 SASI_Mm01_00082662 predicted 818
4 SASI_Mm01_00082663 predicted 695
5 SASI_Mm01_00082664 predicted 1341
6 SASI_Mm01_00082665 predicted 1156
7 SASI_Mm01_00082666 predicted 566
8 SASI_Mm01_00082667 predicted 969
9 SASI_Mm01_00082668 predicted 1236
10 SASI_Mm01_00082669 predicted 465
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021394
ZBP1 MISSION shRNA Bacterial Glycerol Stock
Z-DNA binding protein 1
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077358    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021394.1-1713s1c1
Sequence:CCGGGCTCCTAGACTTTAGATAGATCTCGAGATCTATCTAAAGTCTAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021394.1-605s1c1
Sequence:CCGGGCGATTATTTGTCAGCACAATCTCGAGATTGTGCTGACAAATAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021394.1-487s1c1
Sequence:CCGGCCTGTATTCCATGAGAAATAACTCGAGTTATTTCTCATGGAATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021394.1-1025s1c1
Sequence:CCGGGTCCAGACAGTCCACATCAAACTCGAGTTTGATGTGGACTGTCTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021394.1-377s1c1
Sequence:CCGGCCTAGCCTTGATGAAAGAATACTCGAGTATTCTTTCATCAAGGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436523    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021394.2-1530s21c1
Sequence:CCGGTCCGCATATCCATGTAGATTGCTCGAGCAATCTACATGGATATGCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021394
ZBP1 MISSION shRNA shRNA Plasmid DNA
Z-DNA binding protein 1
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077358    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021394.1-1713s1c1
Sequence:CCGGGCTCCTAGACTTTAGATAGATCTCGAGATCTATCTAAAGTCTAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021394.1-605s1c1
Sequence:CCGGGCGATTATTTGTCAGCACAATCTCGAGATTGTGCTGACAAATAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021394.1-487s1c1
Sequence:CCGGCCTGTATTCCATGAGAAATAACTCGAGTTATTTCTCATGGAATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021394.1-1025s1c1
Sequence:CCGGGTCCAGACAGTCCACATCAAACTCGAGTTTGATGTGGACTGTCTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021394.1-377s1c1
Sequence:CCGGCCTAGCCTTGATGAAAGAATACTCGAGTATTCTTTCATCAAGGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436523    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021394.2-1530s21c1
Sequence:CCGGTCCGCATATCCATGTAGATTGCTCGAGCAATCTACATGGATATGCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021394
ZBP1 MISSION shRNA Lentiviral Transduction Particles
Z-DNA binding protein 1
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077358    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021394.1-1713s1c1
Sequence:CCGGGCTCCTAGACTTTAGATAGATCTCGAGATCTATCTAAAGTCTAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021394.1-605s1c1
Sequence:CCGGGCGATTATTTGTCAGCACAATCTCGAGATTGTGCTGACAAATAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021394.1-487s1c1
Sequence:CCGGCCTGTATTCCATGAGAAATAACTCGAGTTATTTCTCATGGAATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021394.1-1025s1c1
Sequence:CCGGGTCCAGACAGTCCACATCAAACTCGAGTTTGATGTGGACTGTCTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021394.1-377s1c1
Sequence:CCGGCCTAGCCTTGATGAAAGAATACTCGAGTATTCTTTCATCAAGGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436523    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021394.2-1530s21c1
Sequence:CCGGTCCGCATATCCATGTAGATTGCTCGAGCAATCTACATGGATATGCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030776
ZBP1 MISSION shRNA Bacterial Glycerol Stock
Z-DNA binding protein 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030776.1-724s1c1
Sequence:CCGGGCACAATCCAATCAACATGATCTCGAGATCATGTTGATTGGATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030776.1-1144s1c1
Sequence:CCGGCCACATGAAATCGTGCTTTCTCTCGAGAGAAAGCACGATTTCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123049    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030776.1-1924s1c1
Sequence:CCGGGCGGATCAATAGGTCAGGAAACTCGAGTTTCCTGACCTATTGATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030776.1-316s1c1
Sequence:CCGGCCAAGTCCTCTACCGAATGAACTCGAGTTCATTCGGTAGAGGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030776.1-601s1c1
Sequence:CCGGCCGAGACTTGTACAGGATGAACTCGAGTTCATCCTGTACAAGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030776.2-886s21c1
Sequence:CCGGACTCCGAAGCCATCCAGATTGCTCGAGCAATCTGGATGGCTTCGGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030776.2-857s21c1
Sequence:CCGGTGGACCCAACAGCTGGATTTCCTCGAGGAAATCCAGCTGTTGGGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030776
ZBP1 MISSION shRNA shRNA Plasmid DNA
Z-DNA binding protein 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030776.1-724s1c1
Sequence:CCGGGCACAATCCAATCAACATGATCTCGAGATCATGTTGATTGGATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030776.1-1144s1c1
Sequence:CCGGCCACATGAAATCGTGCTTTCTCTCGAGAGAAAGCACGATTTCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123049    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030776.1-1924s1c1
Sequence:CCGGGCGGATCAATAGGTCAGGAAACTCGAGTTTCCTGACCTATTGATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030776.1-316s1c1
Sequence:CCGGCCAAGTCCTCTACCGAATGAACTCGAGTTCATTCGGTAGAGGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030776.1-601s1c1
Sequence:CCGGCCGAGACTTGTACAGGATGAACTCGAGTTCATCCTGTACAAGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030776.2-886s21c1
Sequence:CCGGACTCCGAAGCCATCCAGATTGCTCGAGCAATCTGGATGGCTTCGGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030776.2-857s21c1
Sequence:CCGGTGGACCCAACAGCTGGATTTCCTCGAGGAAATCCAGCTGTTGGGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030776
ZBP1 MISSION shRNA Lentiviral Transduction Particles
Z-DNA binding protein 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030776.1-724s1c1
Sequence:CCGGGCACAATCCAATCAACATGATCTCGAGATCATGTTGATTGGATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030776.1-1144s1c1
Sequence:CCGGCCACATGAAATCGTGCTTTCTCTCGAGAGAAAGCACGATTTCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123049    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030776.1-1924s1c1
Sequence:CCGGGCGGATCAATAGGTCAGGAAACTCGAGTTTCCTGACCTATTGATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030776.1-316s1c1
Sequence:CCGGCCAAGTCCTCTACCGAATGAACTCGAGTTCATTCGGTAGAGGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030776.1-601s1c1
Sequence:CCGGCCGAGACTTGTACAGGATGAACTCGAGTTCATCCTGTACAAGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030776.2-886s21c1
Sequence:CCGGACTCCGAAGCCATCCAGATTGCTCGAGCAATCTGGATGGCTTCGGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030776.2-857s21c1
Sequence:CCGGTGGACCCAACAGCTGGATTTCCTCGAGGAAATCCAGCTGTTGGGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks