EMAIL THIS PAGE TO A FRIEND

ZBTB10

zinc finger and BTB domain containing 10

Synonyms: RINZF
UniProtKB ID: Q96DT7, A4FVD0, Q86W96, Q8IXI9, Q96MH9
Gene ID:
Mouse(229055) zinc finger and BTB domain containing 10
Rat(80338) zinc finger and BTB domain containing 10
cow(785123) zinc finger and BTB domain containing 10
sheep(101112326) zinc finger and BTB domain containing 10
Domestic Rabbit(100346183) zinc finger and BTB domain containing 10
naked mole-rat(101709448) zinc finger and BTB domain containing 10
domestic guinea pig(100725271) zinc finger and BTB domain containing 10
Zebrafish(566269) zinc finger and BTB domain containing 10
Horse(100050624) zinc finger and BTB domain containing 10
chicken(428366) zinc finger and BTB domain containing 10
dog(487014) zinc finger and BTB domain containing 10
domestic cat(101091596) zinc finger and BTB domain containing 10
151 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177660 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177660 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177660 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_023929 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_023929 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_023929 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU072931 MISSION® esiRNA esiRNA targeting mouse Zbtb10 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001105539 Rosetta Predictions human pricing
NM_023929 Rosetta Predictions human pricing
NM_024489 Rosetta Predictions rat pricing
XM_001481285 Rosetta Predictions mouse pricing
XM_485202 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105539 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324281 predicted 2119
2 SASI_Hs02_00324282 predicted 1858
3 SASI_Hs02_00324283 predicted 1594
4 SASI_Hs02_00324284 predicted 3054
5 SASI_Hs02_00324285 predicted 1615
6 SASI_Hs02_00324286 predicted 2994
7 SASI_Hs02_00324287 predicted 1621
8 SASI_Hs02_00324288 predicted 1937
9 SASI_Hs02_00324289 predicted 2371
10 SASI_Hs02_00324290 predicted 2359
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023929 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104402 predicted 2116
2 SASI_Hs02_00356391 predicted 1853
3 SASI_Hs02_00356392 predicted 1596
4 SASI_Hs01_00104404 predicted 2983
5 SASI_Hs01_00104409 predicted 1609
6 SASI_Hs01_00104405 predicted 2923
7 SASI_Hs01_00104407 predicted 1624
8 SASI_Hs01_00104408 predicted 1933
9 SASI_Hs02_00356393 predicted 2373
10 SASI_Hs01_00104410 predicted 2364
11 SASI_Hs01_00104403 predicted 2294
12 SASI_Hs01_00104406 predicted 2587
13 SASI_Hs01_00104411 predicted 2249
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024489 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00031280 predicted 2918
2 SASI_Rn01_00031281 predicted 2579
3 SASI_Rn01_00031282 predicted 2298
4 SASI_Rn01_00031283 predicted 1606
5 SASI_Rn01_00031284 predicted 1573
6 SASI_Rn01_00031285 predicted 1585
7 SASI_Rn01_00031286 predicted 2809
8 SASI_Rn01_00031287 predicted 2590
9 SASI_Rn01_00031288 predicted 1995
10 SASI_Rn02_00264027 predicted 1780
11 SASI_Rn01_00031279 predicted 2798
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001481285 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00423404 predicted 2028
2 SASI_Mm02_00423405 predicted 850
3 SASI_Mm02_00423406 predicted 1577
4 SASI_Mm02_00423407 predicted 1917
5 SASI_Mm02_00423408 predicted 769
6 SASI_Mm02_00423409 predicted 2382
7 SASI_Mm02_00423410 predicted 962
8 SASI_Mm02_00423411 predicted 1602
9 SASI_Mm02_00423412 predicted 1933
10 SASI_Mm02_00423413 predicted 2154
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_485202 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00243884 predicted 2980
2 SASI_Mm01_00243886 predicted 1734
3 SASI_Mm01_00243887 predicted 2457
4 SASI_Mm01_00243888 predicted 2873
5 SASI_Mm01_00243889 predicted 1658
6 SASI_Mm01_00243890 predicted 2636
7 SASI_Mm01_00243891 predicted 3338
8 SASI_Mm01_00243892 predicted 2656
9 SASI_Mm01_00243893 predicted 1851
10 SASI_Mm02_00426630 predicted 2495
11 SASI_Mm01_00243885 predicted 3243
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177660
ZBTB10 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 10
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177660.2-263s1c1
Sequence:CCGGCCACACAAGAAACGTGGGAAACTCGAGTTTCCCACGTTTCTTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177660.2-193s1c1
Sequence:CCGGGACTTCAAATTCGGATTGCTACTCGAGTAGCAATCCGAATTTGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177660.2-157s1c1
Sequence:CCGGGATTTCAAGTATGGGTTGCTACTCGAGTAGCAACCCATACTTGAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177660.2-379s1c1
Sequence:CCGGCATTCTGGAGTAAGATCATTTCTCGAGAAATGATCTTACTCCAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177660.2-308s1c1
Sequence:CCGGACAAGTTGAAATGCCCTCATTCTCGAGAATGAGGGCATTTCAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177660.3-2066s21c1
Sequence:CCGGGACCAACTTGGCAAGTAATATCTCGAGATATTACTTGCCAAGTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177660.3-1961s21c1
Sequence:CCGGGTCTGTGGTTGTGGACTATAACTCGAGTTATAGTCCACAACCACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177660
ZBTB10 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 10
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177660.2-263s1c1
Sequence:CCGGCCACACAAGAAACGTGGGAAACTCGAGTTTCCCACGTTTCTTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177660.2-193s1c1
Sequence:CCGGGACTTCAAATTCGGATTGCTACTCGAGTAGCAATCCGAATTTGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177660.2-157s1c1
Sequence:CCGGGATTTCAAGTATGGGTTGCTACTCGAGTAGCAACCCATACTTGAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177660.2-379s1c1
Sequence:CCGGCATTCTGGAGTAAGATCATTTCTCGAGAAATGATCTTACTCCAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177660.2-308s1c1
Sequence:CCGGACAAGTTGAAATGCCCTCATTCTCGAGAATGAGGGCATTTCAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177660.3-2066s21c1
Sequence:CCGGGACCAACTTGGCAAGTAATATCTCGAGATATTACTTGCCAAGTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177660.3-1961s21c1
Sequence:CCGGGTCTGTGGTTGTGGACTATAACTCGAGTTATAGTCCACAACCACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177660
ZBTB10 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 10
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177660.2-263s1c1
Sequence:CCGGCCACACAAGAAACGTGGGAAACTCGAGTTTCCCACGTTTCTTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177660.2-193s1c1
Sequence:CCGGGACTTCAAATTCGGATTGCTACTCGAGTAGCAATCCGAATTTGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177660.2-157s1c1
Sequence:CCGGGATTTCAAGTATGGGTTGCTACTCGAGTAGCAACCCATACTTGAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177660.2-379s1c1
Sequence:CCGGCATTCTGGAGTAAGATCATTTCTCGAGAAATGATCTTACTCCAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177660.2-308s1c1
Sequence:CCGGACAAGTTGAAATGCCCTCATTCTCGAGAATGAGGGCATTTCAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177660.3-2066s21c1
Sequence:CCGGGACCAACTTGGCAAGTAATATCTCGAGATATTACTTGCCAAGTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177660.3-1961s21c1
Sequence:CCGGGTCTGTGGTTGTGGACTATAACTCGAGTTATAGTCCACAACCACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023929
ZBTB10 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 10
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000165038    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023929.2-1312s1c1
Sequence:CCGGGCCCAAGTCTCTAATGCAGAACTCGAGTTCTGCATTAGAGACTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164357    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023929.2-2924s1c1
Sequence:CCGGCGACGTTATGGTGTTTGTGTACTCGAGTACACAAACACCATAACGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163313    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023929.x-2105s1c1
Sequence:CCGGGCAACACGGAATCTTACCAATCTCGAGATTGGTAAGATTCCGTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160852    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023929.2-3454s1c1
Sequence:CCGGGCTTACATTCATGTGCTACTTCTCGAGAAGTAGCACATGAATGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159344    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023929.2-1755s1c1
Sequence:CCGGGCCGTTTCTTTAAGACTTTATCTCGAGATAAAGTCTTAAAGAAACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159851    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023929.x-2495s1c1
Sequence:CCGGGATAGGAATGTGAATGCAAATCTCGAGATTTGCATTCACATTCCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162604    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023929.2-2106s1c1
Sequence:CCGGCAACACGGAATCTTACCAATTCTCGAGAATTGGTAAGATTCCGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164212    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023929.2-3876s1c1
Sequence:CCGGCGGAGTTGACAAATACCACTACTCGAGTAGTGGTATTTGTCAACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237887    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023929.3-5600s21c1
Sequence:CCGGATATTAGCCTCAGCCTATATACTCGAGTATATAGGCTGAGGCTAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023929.3-3135s21c1
Sequence:CCGGATGATTAACTGACCTACTATACTCGAGTATAGTAGGTCAGTTAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023929.3-1951s21c1
Sequence:CCGGTGTTCAAACTTGCCGAAATTTCTCGAGAAATTTCGGCAAGTTTGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023929.3-2018s21c1
Sequence:CCGGTCTGTAGTTGTGGACTATAATCTCGAGATTATAGTCCACAACTACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023929.3-1756s21c1
Sequence:CCGGCCGTTTCTTTAAGACTTTATACTCGAGTATAAAGTCTTAAAGAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023929
ZBTB10 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 10
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000165038    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023929.2-1312s1c1
Sequence:CCGGGCCCAAGTCTCTAATGCAGAACTCGAGTTCTGCATTAGAGACTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164357    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023929.2-2924s1c1
Sequence:CCGGCGACGTTATGGTGTTTGTGTACTCGAGTACACAAACACCATAACGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163313    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023929.x-2105s1c1
Sequence:CCGGGCAACACGGAATCTTACCAATCTCGAGATTGGTAAGATTCCGTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160852    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023929.2-3454s1c1
Sequence:CCGGGCTTACATTCATGTGCTACTTCTCGAGAAGTAGCACATGAATGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159344    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023929.2-1755s1c1
Sequence:CCGGGCCGTTTCTTTAAGACTTTATCTCGAGATAAAGTCTTAAAGAAACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159851    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023929.x-2495s1c1
Sequence:CCGGGATAGGAATGTGAATGCAAATCTCGAGATTTGCATTCACATTCCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162604    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023929.2-2106s1c1
Sequence:CCGGCAACACGGAATCTTACCAATTCTCGAGAATTGGTAAGATTCCGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164212    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023929.2-3876s1c1
Sequence:CCGGCGGAGTTGACAAATACCACTACTCGAGTAGTGGTATTTGTCAACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237887    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023929.3-5600s21c1
Sequence:CCGGATATTAGCCTCAGCCTATATACTCGAGTATATAGGCTGAGGCTAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023929.3-3135s21c1
Sequence:CCGGATGATTAACTGACCTACTATACTCGAGTATAGTAGGTCAGTTAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023929.3-1951s21c1
Sequence:CCGGTGTTCAAACTTGCCGAAATTTCTCGAGAAATTTCGGCAAGTTTGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023929.3-2018s21c1
Sequence:CCGGTCTGTAGTTGTGGACTATAATCTCGAGATTATAGTCCACAACTACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023929.3-1756s21c1
Sequence:CCGGCCGTTTCTTTAAGACTTTATACTCGAGTATAAAGTCTTAAAGAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023929
ZBTB10 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 10
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000165038    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023929.2-1312s1c1
Sequence:CCGGGCCCAAGTCTCTAATGCAGAACTCGAGTTCTGCATTAGAGACTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164357    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023929.2-2924s1c1
Sequence:CCGGCGACGTTATGGTGTTTGTGTACTCGAGTACACAAACACCATAACGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163313    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023929.x-2105s1c1
Sequence:CCGGGCAACACGGAATCTTACCAATCTCGAGATTGGTAAGATTCCGTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160852    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023929.2-3454s1c1
Sequence:CCGGGCTTACATTCATGTGCTACTTCTCGAGAAGTAGCACATGAATGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159344    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023929.2-1755s1c1
Sequence:CCGGGCCGTTTCTTTAAGACTTTATCTCGAGATAAAGTCTTAAAGAAACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159851    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023929.x-2495s1c1
Sequence:CCGGGATAGGAATGTGAATGCAAATCTCGAGATTTGCATTCACATTCCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162604    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023929.2-2106s1c1
Sequence:CCGGCAACACGGAATCTTACCAATTCTCGAGAATTGGTAAGATTCCGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164212    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023929.2-3876s1c1
Sequence:CCGGCGGAGTTGACAAATACCACTACTCGAGTAGTGGTATTTGTCAACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237887    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023929.3-5600s21c1
Sequence:CCGGATATTAGCCTCAGCCTATATACTCGAGTATATAGGCTGAGGCTAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023929.3-3135s21c1
Sequence:CCGGATGATTAACTGACCTACTATACTCGAGTATAGTAGGTCAGTTAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023929.3-1951s21c1
Sequence:CCGGTGTTCAAACTTGCCGAAATTTCTCGAGAAATTTCGGCAAGTTTGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023929.3-2018s21c1
Sequence:CCGGTCTGTAGTTGTGGACTATAATCTCGAGATTATAGTCCACAACTACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023929.3-1756s21c1
Sequence:CCGGCCGTTTCTTTAAGACTTTATACTCGAGTATAAAGTCTTAAAGAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks