EMAIL THIS PAGE TO A FRIEND

ZBTB11

zinc finger and BTB domain containing 11

Synonyms: ZNF-U69274 ZNF913
UniProtKB ID: O95625, Q2NKP9
Gene ID:
Mouse(271377) zinc finger and BTB domain containing 11
Rat(304010) zinc finger and BTB domain containing 11
chicken(418400) zinc finger and BTB domain containing 11
Horse(100072181) zinc finger and BTB domain containing 11
domestic cat(101095362) zinc finger and BTB domain containing 11
dog(487956) zinc finger and BTB domain containing 11
domestic guinea pig(100736114) zinc finger and BTB domain containing 11
naked mole-rat(101722003) zinc finger and BTB domain containing 11
cow(538545) zinc finger and BTB domain containing 11
sheep(101110114) zinc finger and BTB domain containing 11
154 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014415 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014415 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014415 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_001480244 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_001480244 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_001480244 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014415 Rosetta Predictions human pricing
NM_001107097 Rosetta Predictions rat pricing
XM_001480244 Rosetta Predictions mouse pricing
XM_001481121 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014415 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246500 predicted 1040
2 SASI_Hs02_00345605 predicted 1587
3 SASI_Hs01_00246501 predicted 1448
4 SASI_Hs01_00246503 predicted 3283
5 SASI_Hs02_00345606 predicted 532
6 SASI_Hs02_00345607 predicted 1575
7 SASI_Hs02_00345608 predicted 3418
8 SASI_Hs01_00246505 predicted 1964
9 SASI_Hs02_00345609 predicted 1597
10 SASI_Hs01_00246507 predicted 3231
11 SASI_Hs01_00246502 predicted 2577
12 SASI_Hs01_00246504 predicted 3346
13 SASI_Hs01_00246506 predicted 2189
14 SASI_Hs01_00246508 predicted 749
15 SASI_Hs01_00246509 predicted 685
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107097 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225466 predicted 1403
2 SASI_Rn02_00225467 predicted 826
3 SASI_Rn02_00225468 predicted 1890
4 SASI_Rn02_00225469 predicted 2942
5 SASI_Rn02_00225470 predicted 1944
6 SASI_Rn02_00225471 predicted 2792
7 SASI_Rn02_00225472 predicted 2401
8 SASI_Rn02_00225473 predicted 2180
9 SASI_Rn02_00225474 predicted 2772
10 SASI_Rn02_00225475 predicted 3130
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001480244 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00416177 predicted 3272
2 SASI_Mm02_00416178 predicted 3015
3 SASI_Mm02_00416179 predicted 1947
4 SASI_Mm02_00416180 predicted 2479
5 SASI_Mm02_00416181 predicted 2568
6 SASI_Mm02_00416182 predicted 1913
7 SASI_Mm02_00416183 predicted 2013
8 SASI_Mm02_00416184 predicted 1061
9 SASI_Mm02_00416185 predicted 2859
10 SASI_Mm02_00416186 predicted 2434
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001481121 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00422259 predicted 3276
2 SASI_Mm02_00422260 predicted 3013
3 SASI_Mm02_00422261 predicted 1941
4 SASI_Mm02_00422262 predicted 2473
5 SASI_Mm02_00422263 predicted 2568
6 SASI_Mm02_00422264 predicted 1906
7 SASI_Mm02_00422265 predicted 2015
8 SASI_Mm02_00422266 predicted 1056
9 SASI_Mm02_00422267 predicted 2862
10 SASI_Mm02_00422268 predicted 2434
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014415
VALIDATED
ZBTB11 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 11
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014415.3-2164s21c1
Sequence:CCGGGCAGAACCAAGCGGGAATTTACTCGAGTAAATTCCCGCTTGGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014415.3-2115s21c1
Sequence:CCGGTCGTCCAATTCCACGTCTAATCTCGAGATTAGACGTGGAATTGGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365121    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014415.3-3873s21c1
Sequence:CCGGATAGGATGCATAGGTATATTACTCGAGTAATATACCTATGCATCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014415.3-1314s21c1
Sequence:CCGGGAAATTGTACTACTGGTAAATCTCGAGATTTACCAGTAGTACAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014415.3-1966s21c1
Sequence:CCGGAGAGACGATACGCCCTTATAACTCGAGTTATAAGGGCGTATCGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014415.3-925s21c1
Sequence:CCGGTGTCAGCAAATAGCGAGTATTCTCGAGAATACTCGCTATTTGCTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014415.3-598s21c1
Sequence:CCGGTAGATCGATCCCGTCCAATATCTCGAGATATTGGACGGGATCGATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014415.1-1651s1c1
Sequence:CCGGGCCCTGATGATGATACTTATACTCGAGTATAAGTATCATCATCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144456    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014415.1-3639s1c1
Sequence:CCGGCCGTACAGTTTCATTTGCATTCTCGAGAATGCAAATGAAACTGTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014415.1-1662s1c1
Sequence:CCGGGATACTTATAGAAGCAGGCTTCTCGAGAAGCCTGCTTCTATAAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144539    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014415.1-2508s1c1
Sequence:CCGGCAGCACATGAACAAACATCTTCTCGAGAAGATGTTTGTTCATGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014415.1-2937s1c1
Sequence:CCGGGCTCGAACACTCCGTAAACATCTCGAGATGTTTACGGAGTGTTCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014415.1-2359s1c1
Sequence:CCGGCCAAGTACCTTTGCTCAGTTTCTCGAGAAACTGAGCAAAGGTACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014415.1-3045s1c1
Sequence:CCGGGCACATGCTGTTAGCATCTTACTCGAGTAAGATGCTAACAGCATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014415.1-1545s1c1
Sequence:CCGGGCTGAGGATATTTGTGCCGAACTCGAGTTCGGCACAAATATCCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014415.1-3166s1c1
Sequence:CCGGCTGAAGAGTATCCATCGGTATCTCGAGATACCGATGGATACTCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014415
VALIDATED
ZBTB11 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 11
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014415.3-2164s21c1
Sequence:CCGGGCAGAACCAAGCGGGAATTTACTCGAGTAAATTCCCGCTTGGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014415.3-2115s21c1
Sequence:CCGGTCGTCCAATTCCACGTCTAATCTCGAGATTAGACGTGGAATTGGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365121    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014415.3-3873s21c1
Sequence:CCGGATAGGATGCATAGGTATATTACTCGAGTAATATACCTATGCATCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014415.3-1314s21c1
Sequence:CCGGGAAATTGTACTACTGGTAAATCTCGAGATTTACCAGTAGTACAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014415.3-1966s21c1
Sequence:CCGGAGAGACGATACGCCCTTATAACTCGAGTTATAAGGGCGTATCGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014415.3-925s21c1
Sequence:CCGGTGTCAGCAAATAGCGAGTATTCTCGAGAATACTCGCTATTTGCTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014415.3-598s21c1
Sequence:CCGGTAGATCGATCCCGTCCAATATCTCGAGATATTGGACGGGATCGATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014415.1-1651s1c1
Sequence:CCGGGCCCTGATGATGATACTTATACTCGAGTATAAGTATCATCATCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144456    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014415.1-3639s1c1
Sequence:CCGGCCGTACAGTTTCATTTGCATTCTCGAGAATGCAAATGAAACTGTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014415.1-1662s1c1
Sequence:CCGGGATACTTATAGAAGCAGGCTTCTCGAGAAGCCTGCTTCTATAAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144539    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014415.1-2508s1c1
Sequence:CCGGCAGCACATGAACAAACATCTTCTCGAGAAGATGTTTGTTCATGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014415.1-2937s1c1
Sequence:CCGGGCTCGAACACTCCGTAAACATCTCGAGATGTTTACGGAGTGTTCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014415.1-2359s1c1
Sequence:CCGGCCAAGTACCTTTGCTCAGTTTCTCGAGAAACTGAGCAAAGGTACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014415.1-3045s1c1
Sequence:CCGGGCACATGCTGTTAGCATCTTACTCGAGTAAGATGCTAACAGCATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014415.1-1545s1c1
Sequence:CCGGGCTGAGGATATTTGTGCCGAACTCGAGTTCGGCACAAATATCCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014415.1-3166s1c1
Sequence:CCGGCTGAAGAGTATCCATCGGTATCTCGAGATACCGATGGATACTCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014415
VALIDATED
ZBTB11 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 11
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014415.3-2164s21c1
Sequence:CCGGGCAGAACCAAGCGGGAATTTACTCGAGTAAATTCCCGCTTGGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014415.3-2115s21c1
Sequence:CCGGTCGTCCAATTCCACGTCTAATCTCGAGATTAGACGTGGAATTGGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365121    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014415.3-3873s21c1
Sequence:CCGGATAGGATGCATAGGTATATTACTCGAGTAATATACCTATGCATCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014415.3-1314s21c1
Sequence:CCGGGAAATTGTACTACTGGTAAATCTCGAGATTTACCAGTAGTACAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014415.3-1966s21c1
Sequence:CCGGAGAGACGATACGCCCTTATAACTCGAGTTATAAGGGCGTATCGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014415.3-925s21c1
Sequence:CCGGTGTCAGCAAATAGCGAGTATTCTCGAGAATACTCGCTATTTGCTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014415.3-598s21c1
Sequence:CCGGTAGATCGATCCCGTCCAATATCTCGAGATATTGGACGGGATCGATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014415.1-1651s1c1
Sequence:CCGGGCCCTGATGATGATACTTATACTCGAGTATAAGTATCATCATCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144456    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014415.1-3639s1c1
Sequence:CCGGCCGTACAGTTTCATTTGCATTCTCGAGAATGCAAATGAAACTGTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014415.1-1662s1c1
Sequence:CCGGGATACTTATAGAAGCAGGCTTCTCGAGAAGCCTGCTTCTATAAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144539    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014415.1-2508s1c1
Sequence:CCGGCAGCACATGAACAAACATCTTCTCGAGAAGATGTTTGTTCATGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014415.1-2937s1c1
Sequence:CCGGGCTCGAACACTCCGTAAACATCTCGAGATGTTTACGGAGTGTTCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014415.1-2359s1c1
Sequence:CCGGCCAAGTACCTTTGCTCAGTTTCTCGAGAAACTGAGCAAAGGTACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014415.1-3045s1c1
Sequence:CCGGGCACATGCTGTTAGCATCTTACTCGAGTAAGATGCTAACAGCATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014415.1-1545s1c1
Sequence:CCGGGCTGAGGATATTTGTGCCGAACTCGAGTTCGGCACAAATATCCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014415.1-3166s1c1
Sequence:CCGGCTGAAGAGTATCCATCGGTATCTCGAGATACCGATGGATACTCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001480244
VALIDATED
ZBTB11 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 11
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000236775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001480244.1-614s21c1
Sequence:CCGGTCGATCGCTCCCGTCCAATATCTCGAGATATTGGACGGGAGCGATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_001480244.1-2436s21c1
Sequence:CCGGCAAGTACTTCTGCTCAATTTGCTCGAGCAAATTGAGCAGAAGTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001480244.1-1926s21c1
Sequence:CCGGCACCGAAGAAACGGCTCATAACTCGAGTTATGAGCCGTTTCTTCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257345    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001480244.1-3975s21c1
Sequence:CCGGATGCCTATTAGAGCCTTATTACTCGAGTAATAAGGCTCTAATAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001480244.1-2069s21c1
Sequence:CCGGCATTACGAGCACACCTTATTCCTCGAGGAATAAGGTGTGCTCGTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001480244
VALIDATED
ZBTB11 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 11
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000236775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001480244.1-614s21c1
Sequence:CCGGTCGATCGCTCCCGTCCAATATCTCGAGATATTGGACGGGAGCGATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_001480244.1-2436s21c1
Sequence:CCGGCAAGTACTTCTGCTCAATTTGCTCGAGCAAATTGAGCAGAAGTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001480244.1-1926s21c1
Sequence:CCGGCACCGAAGAAACGGCTCATAACTCGAGTTATGAGCCGTTTCTTCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257345    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001480244.1-3975s21c1
Sequence:CCGGATGCCTATTAGAGCCTTATTACTCGAGTAATAAGGCTCTAATAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001480244.1-2069s21c1
Sequence:CCGGCATTACGAGCACACCTTATTCCTCGAGGAATAAGGTGTGCTCGTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001480244
VALIDATED
ZBTB11 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 11
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000236775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001480244.1-614s21c1
Sequence:CCGGTCGATCGCTCCCGTCCAATATCTCGAGATATTGGACGGGAGCGATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_001480244.1-2436s21c1
Sequence:CCGGCAAGTACTTCTGCTCAATTTGCTCGAGCAAATTGAGCAGAAGTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001480244.1-1926s21c1
Sequence:CCGGCACCGAAGAAACGGCTCATAACTCGAGTTATGAGCCGTTTCTTCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257345    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001480244.1-3975s21c1
Sequence:CCGGATGCCTATTAGAGCCTTATTACTCGAGTAATAAGGCTCTAATAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001480244.1-2069s21c1
Sequence:CCGGCATTACGAGCACACCTTATTCCTCGAGGAATAAGGTGTGCTCGTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks