EMAIL THIS PAGE TO A FRIEND

ZBTB12

zinc finger and BTB domain containing 12

Synonyms: Bat9 C6orf46 D6S59E G10 NG35
UniProtKB ID: Q9Y330, B0UY00, Q5JQ98
Gene ID:
Mouse(193736) zinc finger and BTB domain containing 12
Rat(309613) zinc finger and BTB domain containing 12
domestic cat(101092182) zinc finger and BTB domain containing 12
dog(481719) zinc finger and BTB domain containing 12
cow(100336034) zinc finger and BTB domain containing 12
sheep(101102346) zinc finger and BTB domain containing 12
naked mole-rat(101723450) zinc finger and BTB domain containing 12
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181842 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181842 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181842 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198886 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198886 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198886 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181842 Rosetta Predictions human pricing
NM_001134991 Rosetta Predictions rat pricing
NM_198886 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181842 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022721 predicted 1346
2 SASI_Hs01_00022723 predicted 1371
3 SASI_Hs01_00022724 predicted 320
4 SASI_Hs01_00022725 predicted 338
5 SASI_Hs01_00022726 predicted 387
6 SASI_Hs01_00022727 predicted 1323
7 SASI_Hs01_00022728 predicted 385
8 SASI_Hs01_00022729 predicted 337
9 SASI_Hs01_00022730 predicted 397
10 SASI_Hs02_00370431 predicted 397
11 SASI_Hs01_00022722 predicted 425
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134991 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00259294 predicted 571
2 SASI_Rn02_00259295 predicted 477
3 SASI_Rn02_00259296 predicted 1800
4 SASI_Rn02_00259297 predicted 1990
5 SASI_Rn02_00259298 predicted 1890
6 SASI_Rn02_00259299 predicted 1774
7 SASI_Rn02_00259300 predicted 646
8 SASI_Rn02_00259301 predicted 1892
9 SASI_Rn02_00259302 predicted 466
10 SASI_Rn02_00259303 predicted 1862
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198886 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00050073 predicted 598
2 SASI_Mm02_00351209 predicted 1403
3 SASI_Mm01_00050074 predicted 458
4 SASI_Mm01_00050076 predicted 597
5 SASI_Mm01_00050077 predicted 508
6 SASI_Mm01_00050078 predicted 845
7 SASI_Mm01_00050079 predicted 444
8 SASI_Mm01_00050080 predicted 595
9 SASI_Mm02_00351210 predicted 518
10 SASI_Mm01_00050082 predicted 648
11 SASI_Mm01_00050075 predicted 556
12 SASI_Mm01_00050081 predicted 834
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181842
ZBTB12 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 12
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166111    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181842.1-762s1c1
Sequence:CCGGGAAGAGGATGAGGATGAGGATCTCGAGATCCTCATCCTCATCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161193    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181842.1-1705s1c1
Sequence:CCGGGATGATTCCTTGGAGAGACTTCTCGAGAAGTCTCTCCAAGGAATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159235    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181842.1-1162s1c1
Sequence:CCGGCCTTAAAGAACATCAAGTGCACTCGAGTGCACTTGATGTTCTTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161194    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181842.1-735s1c1
Sequence:CCGGGATGAAGACTTGGAGCTGAAACTCGAGTTTCAGCTCCAAGTCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165491    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181842.1-1535s1c1
Sequence:CCGGGATTAACGTCCTCATCCGCTACTCGAGTAGCGGATGAGGACGTTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164972    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181842.1-791s1c1
Sequence:CCGGGTCTGACATCTGCATCGTCAACTCGAGTTGACGATGCAGATGTCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164949    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181842.1-1354s1c1
Sequence:CCGGGCAAGTGCTTCACACAGAAGTCTCGAGACTTCTGTGTGAAGCACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165432    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181842.1-1721s1c1
Sequence:CCGGGACTTGCTCTTGAGAGTGCAACTCGAGTTGCACTCTCAAGAGCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181842
ZBTB12 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 12
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166111    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181842.1-762s1c1
Sequence:CCGGGAAGAGGATGAGGATGAGGATCTCGAGATCCTCATCCTCATCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161193    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181842.1-1705s1c1
Sequence:CCGGGATGATTCCTTGGAGAGACTTCTCGAGAAGTCTCTCCAAGGAATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159235    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181842.1-1162s1c1
Sequence:CCGGCCTTAAAGAACATCAAGTGCACTCGAGTGCACTTGATGTTCTTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161194    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181842.1-735s1c1
Sequence:CCGGGATGAAGACTTGGAGCTGAAACTCGAGTTTCAGCTCCAAGTCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165491    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181842.1-1535s1c1
Sequence:CCGGGATTAACGTCCTCATCCGCTACTCGAGTAGCGGATGAGGACGTTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164972    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181842.1-791s1c1
Sequence:CCGGGTCTGACATCTGCATCGTCAACTCGAGTTGACGATGCAGATGTCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164949    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181842.1-1354s1c1
Sequence:CCGGGCAAGTGCTTCACACAGAAGTCTCGAGACTTCTGTGTGAAGCACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165432    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181842.1-1721s1c1
Sequence:CCGGGACTTGCTCTTGAGAGTGCAACTCGAGTTGCACTCTCAAGAGCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181842
ZBTB12 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 12
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166111    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181842.1-762s1c1
Sequence:CCGGGAAGAGGATGAGGATGAGGATCTCGAGATCCTCATCCTCATCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161193    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181842.1-1705s1c1
Sequence:CCGGGATGATTCCTTGGAGAGACTTCTCGAGAAGTCTCTCCAAGGAATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159235    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181842.1-1162s1c1
Sequence:CCGGCCTTAAAGAACATCAAGTGCACTCGAGTGCACTTGATGTTCTTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161194    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181842.1-735s1c1
Sequence:CCGGGATGAAGACTTGGAGCTGAAACTCGAGTTTCAGCTCCAAGTCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165491    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181842.1-1535s1c1
Sequence:CCGGGATTAACGTCCTCATCCGCTACTCGAGTAGCGGATGAGGACGTTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164972    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181842.1-791s1c1
Sequence:CCGGGTCTGACATCTGCATCGTCAACTCGAGTTGACGATGCAGATGTCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164949    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181842.1-1354s1c1
Sequence:CCGGGCAAGTGCTTCACACAGAAGTCTCGAGACTTCTGTGTGAAGCACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165432    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181842.1-1721s1c1
Sequence:CCGGGACTTGCTCTTGAGAGTGCAACTCGAGTTGCACTCTCAAGAGCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198886
ZBTB12 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 12
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198886.2-1217s1c1
Sequence:CCGGCCTTAAAGAACATCAAATGCACTCGAGTGCATTTGATGTTCTTTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198886.2-591s1c1
Sequence:CCGGGAACGCCCTTAGCCAGTTCATCTCGAGATGAACTGGCTAAGGGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198886.2-847s1c1
Sequence:CCGGTCTGACATCTGCATCGTCAAACTCGAGTTTGACGATGCAGATGTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198886.2-292s1c1
Sequence:CCGGCGGAACATGAACCAGCTCCGTCTCGAGACGGAGCTGGTTCATGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198886.2-1383s1c1
Sequence:CCGGCAAGTCCCATTCATGTGGCATCTCGAGATGCCACATGAATGGGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198886
ZBTB12 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 12
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198886.2-1217s1c1
Sequence:CCGGCCTTAAAGAACATCAAATGCACTCGAGTGCATTTGATGTTCTTTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198886.2-591s1c1
Sequence:CCGGGAACGCCCTTAGCCAGTTCATCTCGAGATGAACTGGCTAAGGGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198886.2-847s1c1
Sequence:CCGGTCTGACATCTGCATCGTCAAACTCGAGTTTGACGATGCAGATGTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198886.2-292s1c1
Sequence:CCGGCGGAACATGAACCAGCTCCGTCTCGAGACGGAGCTGGTTCATGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198886.2-1383s1c1
Sequence:CCGGCAAGTCCCATTCATGTGGCATCTCGAGATGCCACATGAATGGGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198886
ZBTB12 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 12
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198886.2-1217s1c1
Sequence:CCGGCCTTAAAGAACATCAAATGCACTCGAGTGCATTTGATGTTCTTTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198886.2-591s1c1
Sequence:CCGGGAACGCCCTTAGCCAGTTCATCTCGAGATGAACTGGCTAAGGGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198886.2-847s1c1
Sequence:CCGGTCTGACATCTGCATCGTCAAACTCGAGTTTGACGATGCAGATGTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198886.2-292s1c1
Sequence:CCGGCGGAACATGAACCAGCTCCGTCTCGAGACGGAGCTGGTTCATGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198886.2-1383s1c1
Sequence:CCGGCAAGTCCCATTCATGTGGCATCTCGAGATGCCACATGAATGGGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks