EMAIL THIS PAGE TO A FRIEND

ZBTB14

zinc finger and BTB domain containing 14

Synonyms: ZF5 ZFP-161 ZFP-5 ZFP161 ZNF478
UniProtKB ID: O43829, O00403, Q2TB80
Gene ID:
Mouse(22666) zinc finger and BTB domain containing 14
Zebrafish(406857) zinc finger and BTB domain containing 14
domestic guinea pig(100715952) zinc finger and BTB domain containing 14
naked mole-rat(101702431) zinc finger and BTB domain containing 14
cow(101904037) zinc finger and BTB domain containing 14
96 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009547 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009547 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009547 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003409 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003409 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003409 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003409 Rosetta Predictions human pricing
NM_009547 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003409 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046308 predicted 851
2 SASI_Hs01_00046309 predicted 268
3 SASI_Hs01_00046310 predicted 344
4 SASI_Hs01_00046311 predicted 1061
5 SASI_Hs01_00046313 predicted 1295
6 SASI_Hs01_00046314 predicted 399
7 SASI_Hs02_00335612 predicted 931
8 SASI_Hs02_00335613 predicted 1170
9 SASI_Hs01_00046315 predicted 581
10 SASI_Hs01_00046317 predicted 1051
11 SASI_Hs01_00046312 predicted 434
12 SASI_Hs01_00046316 predicted 1106
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009547 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00113712 predicted 554
2 SASI_Mm01_00113717 predicted 664
3 SASI_Mm01_00113718 predicted 531
4 SASI_Mm01_00113719 predicted 658
5 SASI_Mm02_00316389 predicted 711
6 SASI_Mm02_00316390 predicted 1402
7 SASI_Mm01_00113710 predicted 756
8 SASI_Mm01_00113711 predicted 755
9 SASI_Mm01_00113713 predicted 1111
10 SASI_Mm01_00113714 predicted 1662
11 SASI_Mm01_00113715 predicted 695
12 SASI_Mm01_00113716 predicted 345
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009547
ZBTB14 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 14
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095849    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009547.2-2719s1c1
Sequence:CCGGGCTTCCTTAAATACGTCTGAACTCGAGTTCAGACGTATTTAAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009547.2-502s1c1
Sequence:CCGGGCACGTACTTTAAGAAGCTTTCTCGAGAAAGCTTCTTAAAGTACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009547.2-445s1c1
Sequence:CCGGCCATCGTGGTTGAAGATGTAACTCGAGTTACATCTTCAACCACGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009547.2-1598s1c1
Sequence:CCGGCCAGAGTGAGACAGAACAGTTCTCGAGAACTGTTCTGTCTCACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009547.2-446s1c1
Sequence:CCGGCATCGTGGTTGAAGATGTAAACTCGAGTTTACATCTTCAACCACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009547.2-567s21c1
Sequence:CCGGTTCCTCCGCTCTGACATATTTCTCGAGAAATATGTCAGAGCGGAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009547.2-1283s21c1
Sequence:CCGGCCACCTGAAAGAACACCTAAACTCGAGTTTAGGTGTTCTTTCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009547.2-742s21c1
Sequence:CCGGGCCAGTCGAAGAGTAAGTATTCTCGAGAATACTTACTCTTCGACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271756    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009547.2-1755s21c1
Sequence:CCGGGACCGCTTTGTGGCAATTTACCTCGAGGTAAATTGCCACAAAGCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009547.2-1055s21c1
Sequence:CCGGTGATGGGATGAGCGAAGTAAACTCGAGTTTACTTCGCTCATCCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009547
ZBTB14 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 14
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095849    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009547.2-2719s1c1
Sequence:CCGGGCTTCCTTAAATACGTCTGAACTCGAGTTCAGACGTATTTAAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009547.2-502s1c1
Sequence:CCGGGCACGTACTTTAAGAAGCTTTCTCGAGAAAGCTTCTTAAAGTACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009547.2-445s1c1
Sequence:CCGGCCATCGTGGTTGAAGATGTAACTCGAGTTACATCTTCAACCACGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009547.2-1598s1c1
Sequence:CCGGCCAGAGTGAGACAGAACAGTTCTCGAGAACTGTTCTGTCTCACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009547.2-446s1c1
Sequence:CCGGCATCGTGGTTGAAGATGTAAACTCGAGTTTACATCTTCAACCACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009547.2-567s21c1
Sequence:CCGGTTCCTCCGCTCTGACATATTTCTCGAGAAATATGTCAGAGCGGAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009547.2-1283s21c1
Sequence:CCGGCCACCTGAAAGAACACCTAAACTCGAGTTTAGGTGTTCTTTCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009547.2-742s21c1
Sequence:CCGGGCCAGTCGAAGAGTAAGTATTCTCGAGAATACTTACTCTTCGACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271756    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009547.2-1755s21c1
Sequence:CCGGGACCGCTTTGTGGCAATTTACCTCGAGGTAAATTGCCACAAAGCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009547.2-1055s21c1
Sequence:CCGGTGATGGGATGAGCGAAGTAAACTCGAGTTTACTTCGCTCATCCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009547
ZBTB14 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 14
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095849    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009547.2-2719s1c1
Sequence:CCGGGCTTCCTTAAATACGTCTGAACTCGAGTTCAGACGTATTTAAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009547.2-502s1c1
Sequence:CCGGGCACGTACTTTAAGAAGCTTTCTCGAGAAAGCTTCTTAAAGTACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009547.2-445s1c1
Sequence:CCGGCCATCGTGGTTGAAGATGTAACTCGAGTTACATCTTCAACCACGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009547.2-1598s1c1
Sequence:CCGGCCAGAGTGAGACAGAACAGTTCTCGAGAACTGTTCTGTCTCACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009547.2-446s1c1
Sequence:CCGGCATCGTGGTTGAAGATGTAAACTCGAGTTTACATCTTCAACCACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009547.2-567s21c1
Sequence:CCGGTTCCTCCGCTCTGACATATTTCTCGAGAAATATGTCAGAGCGGAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009547.2-1283s21c1
Sequence:CCGGCCACCTGAAAGAACACCTAAACTCGAGTTTAGGTGTTCTTTCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009547.2-742s21c1
Sequence:CCGGGCCAGTCGAAGAGTAAGTATTCTCGAGAATACTTACTCTTCGACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271756    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009547.2-1755s21c1
Sequence:CCGGGACCGCTTTGTGGCAATTTACCTCGAGGTAAATTGCCACAAAGCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009547.2-1055s21c1
Sequence:CCGGTGATGGGATGAGCGAAGTAAACTCGAGTTTACTTCGCTCATCCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003409
ZBTB14 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 14
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003409.2-1264s1c1
Sequence:CCGGGCCAAGGCATCTGATCTGAAACTCGAGTTTCAGATCAGATGCCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003409.2-287s1c1
Sequence:CCGGCTTCGGTCATAGAAATAGATTCTCGAGAATCTATTTCTATGACCGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003409.2-586s1c1
Sequence:CCGGCCTTCTGATGACACAGTAGAACTCGAGTTCTACTGTGTCATCAGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003409.2-1023s1c1
Sequence:CCGGCCACCTGAAAGAACACCTAAACTCGAGTTTAGGTGTTCTTTCAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003409.2-1132s1c1
Sequence:CCGGCACAGTAATGAAAGACCGTTTCTCGAGAAACGGTCTTTCATTACTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003409.2-278s21c1
Sequence:CCGGTTGATAGTTCTTCGGTCATAGCTCGAGCTATGACCGAAGAACTATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003409.2-1023s21c1
Sequence:CCGGCCACCTGAAAGAACACCTAAACTCGAGTTTAGGTGTTCTTTCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003409.2-853s21c1
Sequence:GTACCGGGACATGAAGTTTGAGTATTTGCTCGAGCAAATACTCAAACTTCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229273    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003409.2-2250s21c1
Sequence:CCGGCCCAAGATTTCCTAGATTAAACTCGAGTTTAATCTAGGAAATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003409.2-406s21c1
Sequence:CCGGCAGATTCTTGGTATCCGATTTCTCGAGAAATCGGATACCAAGAATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003409
ZBTB14 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 14
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003409.2-1264s1c1
Sequence:CCGGGCCAAGGCATCTGATCTGAAACTCGAGTTTCAGATCAGATGCCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003409.2-287s1c1
Sequence:CCGGCTTCGGTCATAGAAATAGATTCTCGAGAATCTATTTCTATGACCGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003409.2-586s1c1
Sequence:CCGGCCTTCTGATGACACAGTAGAACTCGAGTTCTACTGTGTCATCAGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003409.2-1023s1c1
Sequence:CCGGCCACCTGAAAGAACACCTAAACTCGAGTTTAGGTGTTCTTTCAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003409.2-1132s1c1
Sequence:CCGGCACAGTAATGAAAGACCGTTTCTCGAGAAACGGTCTTTCATTACTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003409.2-278s21c1
Sequence:CCGGTTGATAGTTCTTCGGTCATAGCTCGAGCTATGACCGAAGAACTATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003409.2-1023s21c1
Sequence:CCGGCCACCTGAAAGAACACCTAAACTCGAGTTTAGGTGTTCTTTCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003409.2-853s21c1
Sequence:GTACCGGGACATGAAGTTTGAGTATTTGCTCGAGCAAATACTCAAACTTCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229273    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003409.2-2250s21c1
Sequence:CCGGCCCAAGATTTCCTAGATTAAACTCGAGTTTAATCTAGGAAATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003409.2-406s21c1
Sequence:CCGGCAGATTCTTGGTATCCGATTTCTCGAGAAATCGGATACCAAGAATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003409
ZBTB14 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 14
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003409.2-1264s1c1
Sequence:CCGGGCCAAGGCATCTGATCTGAAACTCGAGTTTCAGATCAGATGCCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003409.2-287s1c1
Sequence:CCGGCTTCGGTCATAGAAATAGATTCTCGAGAATCTATTTCTATGACCGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003409.2-586s1c1
Sequence:CCGGCCTTCTGATGACACAGTAGAACTCGAGTTCTACTGTGTCATCAGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003409.2-1023s1c1
Sequence:CCGGCCACCTGAAAGAACACCTAAACTCGAGTTTAGGTGTTCTTTCAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003409.2-1132s1c1
Sequence:CCGGCACAGTAATGAAAGACCGTTTCTCGAGAAACGGTCTTTCATTACTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003409.2-278s21c1
Sequence:CCGGTTGATAGTTCTTCGGTCATAGCTCGAGCTATGACCGAAGAACTATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003409.2-1023s21c1
Sequence:CCGGCCACCTGAAAGAACACCTAAACTCGAGTTTAGGTGTTCTTTCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003409.2-853s21c1
Sequence:GTACCGGGACATGAAGTTTGAGTATTTGCTCGAGCAAATACTCAAACTTCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229273    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003409.2-2250s21c1
Sequence:CCGGCCCAAGATTTCCTAGATTAAACTCGAGTTTAATCTAGGAAATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003409.2-406s21c1
Sequence:CCGGCAGATTCTTGGTATCCGATTTCTCGAGAAATCGGATACCAAGAATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks