EMAIL THIS PAGE TO A FRIEND

ZBTB16

zinc finger and BTB domain containing 16

Synonyms: PLZF ZNF145
UniProtKB ID: Q05516, Q8TAL4
Gene ID:
Human(7704) Summary: This gene is a member of the Krueppel C2H2-type zinc-finger protein family and encodes a zinc finger transcription factor that contains nine Kruppel-type zinc finger domains at the carboxyl terminus. This protein is located in the nucleus, is involved in cell cycle progression, and interacts with a histone deacetylase. Specific instances of aberrant gene rearrangement at this locus have been associated with acute promyelocytic leukemia (APL). Alternate transcriptional splice variants have been characterized. [provided by RefSeq, Jul 2008]
Mouse(235320) zinc finger and BTB domain containing 16
Rat(353227) zinc finger and BTB domain containing 16
cow(534401) zinc finger and BTB domain containing 16
sheep(101110790) zinc finger and BTB domain containing 16
naked mole-rat(101714671) zinc finger and BTB domain containing 16
Domestic Rabbit(100340808) zinc finger and BTB domain containing 16
domestic guinea pig(100732029) zinc finger and BTB domain containing 16
chicken(419759) zinc finger and BTB domain containing 16
Horse(100062269) zinc finger and BTB domain containing 16
dog(489398) zinc finger and BTB domain containing 16
domestic cat(101098251) zinc finger and BTB domain containing 16
68 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006006 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006006 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006006 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033324 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033324 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033324 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU083931 MISSION® esiRNA esiRNA human ZBTB16 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001018011 Rosetta Predictions human pricing
NM_006006 Rosetta Predictions human pricing
NM_001013181 Rosetta Predictions rat pricing
NM_001033324 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018011 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148555 predicted 297
2 SASI_Hs01_00148556 predicted 1081
3 SASI_Hs01_00148557 predicted 717
4 SASI_Hs01_00148559 predicted 1131
5 SASI_Hs01_00148560 predicted 1431
6 SASI_Hs01_00148561 predicted 1446
7 SASI_Hs01_00148562 predicted 333
8 SASI_Hs02_00306903 predicted 988
9 SASI_Hs01_00148564 predicted 1487
10 SASI_Hs02_00306904 predicted 1874
11 SASI_Hs01_00148558 predicted 350
12 SASI_Hs01_00148563 predicted 354
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006006 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170989 predicted 454
2 SASI_Hs01_00170990 predicted 1243
3 SASI_Hs01_00170991 predicted 868
4 SASI_Hs01_00170993 predicted 1290
5 SASI_Hs01_00170994 predicted 1580
6 SASI_Hs01_00170995 predicted 1604
7 SASI_Hs01_00170996 predicted 485
8 SASI_Hs02_00340711 predicted 1142
9 SASI_Hs01_00170998 predicted 1650
10 SASI_Hs02_00340712 predicted 2035
11 SASI_Hs01_00170992 predicted 511
12 SASI_Hs01_00170997 predicted 504
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013181 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00200937 predicted 604
2 SASI_Rn01_00106030 predicted 765
3 SASI_Rn01_00106031 predicted 1495
4 SASI_Rn01_00106032 predicted 1991
5 SASI_Rn01_00106033 predicted 1480
6 SASI_Rn01_00106034 predicted 471
7 SASI_Rn02_00200938 predicted 1873
8 SASI_Rn01_00106037 predicted 1891
9 SASI_Rn01_00106038 predicted 250
10 SASI_Rn01_00106039 predicted 1792
11 SASI_Rn01_00106035 predicted 417
12 SASI_Rn01_00106036 predicted 1163
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033324 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027913 predicted 551
2 SASI_Mm01_00027914 predicted 687
3 SASI_Mm01_00027915 predicted 1581
4 SASI_Mm01_00027916 predicted 459
5 SASI_Mm01_00027917 predicted 858
6 SASI_Mm01_00027918 predicted 1738
7 SASI_Mm01_00027919 predicted 1965
8 SASI_Mm01_00027920 predicted 1598
9 SASI_Mm01_00027921 predicted 434
10 SASI_Mm01_00027922 predicted 1584
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006006
ZBTB16 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 16
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000367816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006006.4-2024s21c1
Sequence:CCGGATCAGCTGGAGACGCACTATACTCGAGTATAGTGCGTCTCCAGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006006.4-1281s21c1
Sequence:CCGGCCACAAGGCTGACGCTGTATTCTCGAGAATACAGCGTCAGCCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006006.4-1136s21c1
Sequence:CCGGGTGCTAGGGAGCTACACTATGCTCGAGCATAGTGTAGCTCCCTAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006006.4-443s21c1
Sequence:CCGGAGATCCTCTTCCACCGCAATACTCGAGTATTGCGGTGGAAGAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006006.3-435s1c1
Sequence:CCGGCCACCGCAATAGTCAACACTACTCGAGTAGTGTTGACTATTGCGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006006.3-1589s1c1
Sequence:CCGGGAATGCACTTACTGGCTCATTCTCGAGAATGAGCCAGTAAGTGCATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006006.3-440s1c1
Sequence:CCGGGCAATAGTCAACACTATACTTCTCGAGAAGTATAGTGTTGACTATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006006.3-853s1c1
Sequence:CCGGGTGGACAGTTTGATGACCATACTCGAGTATGGTCATCAAACTGTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006006
ZBTB16 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 16
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000367816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006006.4-2024s21c1
Sequence:CCGGATCAGCTGGAGACGCACTATACTCGAGTATAGTGCGTCTCCAGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006006.4-1281s21c1
Sequence:CCGGCCACAAGGCTGACGCTGTATTCTCGAGAATACAGCGTCAGCCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006006.4-1136s21c1
Sequence:CCGGGTGCTAGGGAGCTACACTATGCTCGAGCATAGTGTAGCTCCCTAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006006.4-443s21c1
Sequence:CCGGAGATCCTCTTCCACCGCAATACTCGAGTATTGCGGTGGAAGAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006006.3-435s1c1
Sequence:CCGGCCACCGCAATAGTCAACACTACTCGAGTAGTGTTGACTATTGCGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006006.3-1589s1c1
Sequence:CCGGGAATGCACTTACTGGCTCATTCTCGAGAATGAGCCAGTAAGTGCATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006006.3-440s1c1
Sequence:CCGGGCAATAGTCAACACTATACTTCTCGAGAAGTATAGTGTTGACTATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006006.3-853s1c1
Sequence:CCGGGTGGACAGTTTGATGACCATACTCGAGTATGGTCATCAAACTGTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006006
ZBTB16 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 16
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000367816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006006.4-2024s21c1
Sequence:CCGGATCAGCTGGAGACGCACTATACTCGAGTATAGTGCGTCTCCAGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006006.4-1281s21c1
Sequence:CCGGCCACAAGGCTGACGCTGTATTCTCGAGAATACAGCGTCAGCCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006006.4-1136s21c1
Sequence:CCGGGTGCTAGGGAGCTACACTATGCTCGAGCATAGTGTAGCTCCCTAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006006.4-443s21c1
Sequence:CCGGAGATCCTCTTCCACCGCAATACTCGAGTATTGCGGTGGAAGAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006006.3-435s1c1
Sequence:CCGGCCACCGCAATAGTCAACACTACTCGAGTAGTGTTGACTATTGCGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006006.3-1589s1c1
Sequence:CCGGGAATGCACTTACTGGCTCATTCTCGAGAATGAGCCAGTAAGTGCATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006006.3-440s1c1
Sequence:CCGGGCAATAGTCAACACTATACTTCTCGAGAAGTATAGTGTTGACTATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006006.3-853s1c1
Sequence:CCGGGTGGACAGTTTGATGACCATACTCGAGTATGGTCATCAAACTGTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033324
VALIDATED
ZBTB16 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 16
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000239238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033324.2-855s21c1
Sequence:CCGGTGGACAGCTTGATGAGTATAGCTCGAGCTATACTCATCAAGCTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033324.2-1581s21c1
Sequence:CCGGTGCGACTGAGAATGCATTTACCTCGAGGTAAATGCATTCTCAGTCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033324.2-2243s21c1
Sequence:CCGGACGTACCTCTACCTGTGTTATCTCGAGATAACACAGGTAGAGGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239235    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033324.2-4023s21c1
Sequence:CCGGCGTGGTCTCCTGCCGTTAATACTCGAGTATTAACGGCAGGAGACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033324.2-1785s21c1
Sequence:CCGGCAGGCGTGCGCAGCTATATTTCTCGAGAAATATAGCTGCGCACGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033324
VALIDATED
ZBTB16 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 16
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000239238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033324.2-855s21c1
Sequence:CCGGTGGACAGCTTGATGAGTATAGCTCGAGCTATACTCATCAAGCTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033324.2-1581s21c1
Sequence:CCGGTGCGACTGAGAATGCATTTACCTCGAGGTAAATGCATTCTCAGTCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033324.2-2243s21c1
Sequence:CCGGACGTACCTCTACCTGTGTTATCTCGAGATAACACAGGTAGAGGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239235    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033324.2-4023s21c1
Sequence:CCGGCGTGGTCTCCTGCCGTTAATACTCGAGTATTAACGGCAGGAGACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033324.2-1785s21c1
Sequence:CCGGCAGGCGTGCGCAGCTATATTTCTCGAGAAATATAGCTGCGCACGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033324
VALIDATED
ZBTB16 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 16
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000239238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033324.2-855s21c1
Sequence:CCGGTGGACAGCTTGATGAGTATAGCTCGAGCTATACTCATCAAGCTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033324.2-1581s21c1
Sequence:CCGGTGCGACTGAGAATGCATTTACCTCGAGGTAAATGCATTCTCAGTCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033324.2-2243s21c1
Sequence:CCGGACGTACCTCTACCTGTGTTATCTCGAGATAACACAGGTAGAGGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239235    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033324.2-4023s21c1
Sequence:CCGGCGTGGTCTCCTGCCGTTAATACTCGAGTATTAACGGCAGGAGACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033324.2-1785s21c1
Sequence:CCGGCAGGCGTGCGCAGCTATATTTCTCGAGAAATATAGCTGCGCACGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks