EMAIL THIS PAGE TO A FRIEND

ZBTB17

zinc finger and BTB domain containing 17

Synonyms: MIZ-1 ZNF151 ZNF60 pHZ-67
Gene ID:
Human(7709) Summary: This gene encodes a zinc finger protein involved in the regulation of c-myc. The symbol MIZ1 has also been associated with PIAS2 which is a different gene located on chromosome 18. [provided by RefSeq, Jul 2008]
Mouse(22642) zinc finger and BTB domain containing 17
Rat(313666) zinc finger and BTB domain containing 17
chicken(396541) zinc finger and BTB domain containing 17
Horse(100050436) zinc finger and BTB domain containing 17
domestic cat(101084723) zinc finger and BTB domain containing 17
dog(607083) zinc finger and BTB domain containing 17
domestic guinea pig(100731568) zinc finger and BTB domain containing 17
Domestic Rabbit(100348036) zinc finger and BTB domain containing 17
naked mole-rat(101710815) zinc finger and BTB domain containing 17
cow(512915) zinc finger and BTB domain containing 17
sheep(101108588) zinc finger and BTB domain containing 17
63 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003443 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003443 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003443 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009541 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009541 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009541 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003443 Rosetta Predictions human pricing
NM_001012105 Rosetta Predictions rat pricing
XM_575944 Rosetta Predictions rat pricing
NM_009541 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003443 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00335670 predicted 459
2 SASI_Hs01_00161016 predicted 1826
3 SASI_Hs01_00161017 predicted 1948
4 SASI_Hs01_00161018 predicted 2489
5 SASI_Hs01_00161019 predicted 2327
6 SASI_Hs02_00335671 predicted 1667
7 SASI_Hs02_00335672 predicted 1230
8 SASI_Hs01_00161021 predicted 1978
9 SASI_Hs02_00335673 predicted 1421
10 SASI_Hs01_00161022 predicted 2068
11 SASI_Hs01_00161015 predicted 231
12 SASI_Hs01_00161020 predicted 2189
13 SASI_Hs01_00161023 predicted 204
14 SASI_Hs01_00161024 predicted 1986
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012105 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00091758 predicted 1436
2 SASI_Rn02_00200251 predicted 2354
3 SASI_Rn01_00091759 predicted 506
4 SASI_Rn01_00091760 predicted 2114
5 SASI_Rn01_00091761 predicted 2337
6 SASI_Rn01_00091763 predicted 1686
7 SASI_Rn01_00091764 predicted 1912
8 SASI_Rn01_00091765 predicted 1185
9 SASI_Rn02_00200252 predicted 733
10 SASI_Rn01_00091766 predicted 2414
11 SASI_Rn01_00091757 predicted 1971
12 SASI_Rn01_00091762 predicted 2342
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575944 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00153475 predicted 1898
2 SASI_Rn01_00153476 predicted 1374
3 SASI_Rn01_00153477 predicted 2044
4 SASI_Rn01_00153478 predicted 2268
5 SASI_Rn01_00153479 predicted 2279
6 SASI_Rn01_00153480 predicted 1623
7 SASI_Rn01_00153481 predicted 1852
8 SASI_Rn01_00153482 predicted 1118
9 SASI_Rn01_00153483 predicted 2356
10 SASI_Rn01_00153484 predicted 1775
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009541 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00098450 predicted 2275
2 SASI_Mm01_00098451 predicted 2027
3 SASI_Mm01_00098452 predicted 1781
4 SASI_Mm01_00098453 predicted 2045
5 SASI_Mm01_00098454 predicted 438
6 SASI_Mm01_00098456 predicted 1123
7 SASI_Mm01_00098457 predicted 471
8 SASI_Mm02_00316374 predicted 1926
9 SASI_Mm02_00316375 predicted 2263
10 SASI_Mm02_00316376 predicted 896
11 SASI_Mm01_00098455 predicted 2282
12 SASI_Mm01_00098458 predicted 1595
13 SASI_Mm01_00098459 predicted 1917
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003443
VALIDATED
ZBTB17 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 17
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_003443.1-264s1c1
Sequence:CCGGCGAGTACTTCAAGATGCTCTTCTCGAGAAGAGCATCTTGAAGTACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_003443.1-1926s1c1
Sequence:CCGGCCTGTCCAAGCACATCATCATCTCGAGATGATGATGTGCTTGGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_003443.1-221s1c1
Sequence:CCGGGTGTTCACTTTAAGGCTCATACTCGAGTATGAGCCTTAAAGTGAACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003443.2-1951s21c1
Sequence:CCGGGCCAGTTGGCCAATCATATTCCTCGAGGAATATGATTGGCCAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003443.2-2041s21c1
Sequence:CCGGTGTCCAAGCACATCATCATTCCTCGAGGAATGATGATGTGCTTGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003443.2-336s21c1
Sequence:CCGGGTTCACTTTAAGGCTCATAAACTCGAGTTTATGAGCCTTAAAGTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003443.2-417s21c1
Sequence:CCGGGTGCACCTGGACATCAGTAACCTCGAGGTTACTGATGTCCAGGTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003443.2-884s21c1
Sequence:CCGGCGAGAGCTCGGAGCAAGAAATCTCGAGATTTCTTGCTCCGAGCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003443
VALIDATED
ZBTB17 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 17
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_003443.1-264s1c1
Sequence:CCGGCGAGTACTTCAAGATGCTCTTCTCGAGAAGAGCATCTTGAAGTACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_003443.1-1926s1c1
Sequence:CCGGCCTGTCCAAGCACATCATCATCTCGAGATGATGATGTGCTTGGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_003443.1-221s1c1
Sequence:CCGGGTGTTCACTTTAAGGCTCATACTCGAGTATGAGCCTTAAAGTGAACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003443.2-1951s21c1
Sequence:CCGGGCCAGTTGGCCAATCATATTCCTCGAGGAATATGATTGGCCAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003443.2-2041s21c1
Sequence:CCGGTGTCCAAGCACATCATCATTCCTCGAGGAATGATGATGTGCTTGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003443.2-336s21c1
Sequence:CCGGGTTCACTTTAAGGCTCATAAACTCGAGTTTATGAGCCTTAAAGTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003443.2-417s21c1
Sequence:CCGGGTGCACCTGGACATCAGTAACCTCGAGGTTACTGATGTCCAGGTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003443.2-884s21c1
Sequence:CCGGCGAGAGCTCGGAGCAAGAAATCTCGAGATTTCTTGCTCCGAGCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003443
VALIDATED
ZBTB17 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 17
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_003443.1-264s1c1
Sequence:CCGGCGAGTACTTCAAGATGCTCTTCTCGAGAAGAGCATCTTGAAGTACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_003443.1-1926s1c1
Sequence:CCGGCCTGTCCAAGCACATCATCATCTCGAGATGATGATGTGCTTGGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_003443.1-221s1c1
Sequence:CCGGGTGTTCACTTTAAGGCTCATACTCGAGTATGAGCCTTAAAGTGAACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003443.2-1951s21c1
Sequence:CCGGGCCAGTTGGCCAATCATATTCCTCGAGGAATATGATTGGCCAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003443.2-2041s21c1
Sequence:CCGGTGTCCAAGCACATCATCATTCCTCGAGGAATGATGATGTGCTTGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003443.2-336s21c1
Sequence:CCGGGTTCACTTTAAGGCTCATAAACTCGAGTTTATGAGCCTTAAAGTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003443.2-417s21c1
Sequence:CCGGGTGCACCTGGACATCAGTAACCTCGAGGTTACTGATGTCCAGGTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003443.2-884s21c1
Sequence:CCGGCGAGAGCTCGGAGCAAGAAATCTCGAGATTTCTTGCTCCGAGCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009541
VALIDATED
ZBTB17 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 17
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009541.1-1567s1c1
Sequence:CCGGGCCCACTTGAAGATCCACATTCTCGAGAATGTGGATCTTCAAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009541.1-1770s1c1
Sequence:CCGGCCAGTGTGTGATATGTGGTAACTCGAGTTACCACATATCACACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009541.1-303s1c1
Sequence:CCGGCGTTGACTTCAAGGCTCACAACTCGAGTTGTGAGCCTTGAAGTCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009541.1-2061s1c1
Sequence:CCGGCAACCTGCGTTCTCATGTAAACTCGAGTTTACATGAGAACGCAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009541.1-1980s1c1
Sequence:CCGGCCTGTCCAAGCACATTATCATCTCGAGATGATAATGTGCTTGGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436068    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009541.2-2747s21c1
Sequence:CCGGACCTATACAAGTGACAATTTACTCGAGTAAATTGTCACTTGTATAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009541.2-1873s21c1
Sequence:CCGGGAACGCTGTGGCAAGAGATTTCTCGAGAAATCTCTTGCCACAGCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009541.2-2261s21c1
Sequence:CCGGACGAGACGGAAGTACTCAAAGCTCGAGCTTTGAGTACTTCCGTCTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009541.2-2364s21c1
Sequence:CCGGCAAGTTCCTGGATGCCAATAGCTCGAGCTATTGGCATCCAGGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418306    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009541.2-2795s21c1
Sequence:CCGGTCATACCATCCTAAGCTATTCCTCGAGGAATAGCTTAGGATGGTATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009541
VALIDATED
ZBTB17 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 17
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009541.1-1567s1c1
Sequence:CCGGGCCCACTTGAAGATCCACATTCTCGAGAATGTGGATCTTCAAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009541.1-1770s1c1
Sequence:CCGGCCAGTGTGTGATATGTGGTAACTCGAGTTACCACATATCACACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009541.1-303s1c1
Sequence:CCGGCGTTGACTTCAAGGCTCACAACTCGAGTTGTGAGCCTTGAAGTCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009541.1-2061s1c1
Sequence:CCGGCAACCTGCGTTCTCATGTAAACTCGAGTTTACATGAGAACGCAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009541.1-1980s1c1
Sequence:CCGGCCTGTCCAAGCACATTATCATCTCGAGATGATAATGTGCTTGGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436068    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009541.2-2747s21c1
Sequence:CCGGACCTATACAAGTGACAATTTACTCGAGTAAATTGTCACTTGTATAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009541.2-1873s21c1
Sequence:CCGGGAACGCTGTGGCAAGAGATTTCTCGAGAAATCTCTTGCCACAGCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009541.2-2261s21c1
Sequence:CCGGACGAGACGGAAGTACTCAAAGCTCGAGCTTTGAGTACTTCCGTCTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009541.2-2364s21c1
Sequence:CCGGCAAGTTCCTGGATGCCAATAGCTCGAGCTATTGGCATCCAGGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418306    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009541.2-2795s21c1
Sequence:CCGGTCATACCATCCTAAGCTATTCCTCGAGGAATAGCTTAGGATGGTATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009541
VALIDATED
ZBTB17 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 17
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009541.1-1567s1c1
Sequence:CCGGGCCCACTTGAAGATCCACATTCTCGAGAATGTGGATCTTCAAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009541.1-1770s1c1
Sequence:CCGGCCAGTGTGTGATATGTGGTAACTCGAGTTACCACATATCACACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009541.1-303s1c1
Sequence:CCGGCGTTGACTTCAAGGCTCACAACTCGAGTTGTGAGCCTTGAAGTCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009541.1-2061s1c1
Sequence:CCGGCAACCTGCGTTCTCATGTAAACTCGAGTTTACATGAGAACGCAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009541.1-1980s1c1
Sequence:CCGGCCTGTCCAAGCACATTATCATCTCGAGATGATAATGTGCTTGGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436068    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009541.2-2747s21c1
Sequence:CCGGACCTATACAAGTGACAATTTACTCGAGTAAATTGTCACTTGTATAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009541.2-1873s21c1
Sequence:CCGGGAACGCTGTGGCAAGAGATTTCTCGAGAAATCTCTTGCCACAGCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009541.2-2261s21c1
Sequence:CCGGACGAGACGGAAGTACTCAAAGCTCGAGCTTTGAGTACTTCCGTCTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009541.2-2364s21c1
Sequence:CCGGCAAGTTCCTGGATGCCAATAGCTCGAGCTATTGGCATCCAGGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418306    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009541.2-2795s21c1
Sequence:CCGGTCATACCATCCTAAGCTATTCCTCGAGGAATAGCTTAGGATGGTATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks