EMAIL THIS PAGE TO A FRIEND

ZBTB18

zinc finger and BTB domain containing 18

Synonyms: C2H2-171 RP58 TAZ-1 ZNF238
UniProtKB ID: Q99592, A8K5U3, Q13397, Q5VU40, Q8N463, Q9UD99
Gene ID:
Human(10472) Summary: This gene encodes a C2H2-type zinc finger protein which acts a transcriptional repressor of genes involved in neuronal development. The encoded protein recognizes a specific sequence motif and recruits components of chromatin to target genes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
Mouse(30928) zinc finger and BTB domain containing 18
cow(538793) zinc finger protein 238
naked mole-rat(101698117) zinc finger and BTB domain containing 18
domestic guinea pig(100720725) zinc finger and BTB domain containing 18
Zebrafish(100003157) zinc finger and BTB domain containing 18
207 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006352 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006352 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006352 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013915 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013915 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013915 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU043901 MISSION® esiRNA esiRNA targeting mouse Zfp238 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006352 Rosetta Predictions human pricing
NM_205768 Rosetta Predictions human pricing
NM_001012330 Rosetta Predictions mouse pricing
NM_013915 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006352 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188741 predicted 1424
2 SASI_Hs01_00188742 predicted 1412
3 SASI_Hs01_00188743 predicted 909
4 SASI_Hs01_00188744 predicted 1280
5 SASI_Hs01_00188745 predicted 1341
6 SASI_Hs01_00188746 predicted 1358
7 SASI_Hs01_00188747 predicted 1369
8 SASI_Hs01_00188748 predicted 777
9 SASI_Hs01_00188749 predicted 913
10 SASI_Hs01_00188750 predicted 778
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_205768 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160343 predicted 1104
2 SASI_Hs01_00160344 predicted 1088
3 SASI_Hs01_00160345 predicted 593
4 SASI_Hs01_00160346 predicted 955
5 SASI_Hs01_00160347 predicted 1021
6 SASI_Hs01_00160348 predicted 1037
7 SASI_Hs01_00160349 predicted 1042
8 SASI_Hs01_00160350 predicted 457
9 SASI_Hs01_00160351 predicted 599
10 SASI_Hs01_00160352 predicted 456
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012330 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00079679 predicted 1019
2 SASI_Mm01_00079680 predicted 1080
3 SASI_Mm01_00079681 predicted 1066
4 SASI_Mm02_00287091 predicted 562
5 SASI_Mm01_00079682 predicted 932
6 SASI_Mm01_00079683 predicted 941
7 SASI_Mm01_00079684 predicted 478
8 SASI_Mm01_00079685 predicted 573
9 SASI_Mm01_00079686 predicted 431
10 SASI_Mm01_00079687 predicted 964
11 SASI_Mm01_00079688 predicted 1032
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013915 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00167108 predicted 2126
2 SASI_Mm01_00167109 predicted 2185
3 SASI_Mm01_00167110 predicted 2165
4 SASI_Mm02_00323011 predicted 1671
5 SASI_Mm01_00167111 predicted 2035
6 SASI_Mm01_00167112 predicted 2047
7 SASI_Mm01_00167113 predicted 1585
8 SASI_Mm01_00167114 predicted 1674
9 SASI_Mm01_00167115 predicted 1540
10 SASI_Mm01_00167116 predicted 2077
11 SASI_Mm01_00167117 predicted 2137
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006352
VALIDATED
ZBTB18 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 18
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285475    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006352.3-2149s21c1
Sequence:CCGGATAGTTGTGGTACGGTCTAAACTCGAGTTTAGACCGTACCACAACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006352.3-1367s21c1
Sequence:CCGGAGAGTGATGTTGGCACTAATGCTCGAGCATTAGTGCCAACATCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006352.3-1770s21c1
Sequence:CCGGGAAGACTTTCTCTTGCATGTACTCGAGTACATGCAAGAGAAAGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006352.3-710s21c1
Sequence:CCGGTTCATCTGAACAGCGACATTGCTCGAGCAATGTCGCTGTTCAGATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006352.3-830s21c1
Sequence:CCGGATCTCCACATGTATGACATTGCTCGAGCAATGTCATACATGTGGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_006352.3-2069s1c1
Sequence:CCGGGCTCTCAAGAACTTTGGAAATCTCGAGATTTCCAAAGTTCTTGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_006352.3-784s1c1
Sequence:CCGGCAGTTCAAAGACTTGCCCATTCTCGAGAATGGGCAAGTCTTTGAACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006352.3-1428s1c1
Sequence:CCGGCACTAATAACAGGGTACAGTACTCGAGTACTGTACCCTGTTATTAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006352.3-1770s1c1
Sequence:CCGGGAAGACTTTCTCTTGCATGTACTCGAGTACATGCAAGAGAAAGTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_006352.3-922s1c1
Sequence:CCGGGCTTCAAGTTGTTCGGACAAACTCGAGTTTGTCCGAACAACTTGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006352
VALIDATED
ZBTB18 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 18
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285475    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006352.3-2149s21c1
Sequence:CCGGATAGTTGTGGTACGGTCTAAACTCGAGTTTAGACCGTACCACAACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006352.3-1367s21c1
Sequence:CCGGAGAGTGATGTTGGCACTAATGCTCGAGCATTAGTGCCAACATCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006352.3-1770s21c1
Sequence:CCGGGAAGACTTTCTCTTGCATGTACTCGAGTACATGCAAGAGAAAGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006352.3-710s21c1
Sequence:CCGGTTCATCTGAACAGCGACATTGCTCGAGCAATGTCGCTGTTCAGATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006352.3-830s21c1
Sequence:CCGGATCTCCACATGTATGACATTGCTCGAGCAATGTCATACATGTGGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_006352.3-2069s1c1
Sequence:CCGGGCTCTCAAGAACTTTGGAAATCTCGAGATTTCCAAAGTTCTTGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_006352.3-784s1c1
Sequence:CCGGCAGTTCAAAGACTTGCCCATTCTCGAGAATGGGCAAGTCTTTGAACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006352.3-1428s1c1
Sequence:CCGGCACTAATAACAGGGTACAGTACTCGAGTACTGTACCCTGTTATTAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006352.3-1770s1c1
Sequence:CCGGGAAGACTTTCTCTTGCATGTACTCGAGTACATGCAAGAGAAAGTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_006352.3-922s1c1
Sequence:CCGGGCTTCAAGTTGTTCGGACAAACTCGAGTTTGTCCGAACAACTTGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006352
VALIDATED
ZBTB18 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 18
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285475    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006352.3-2149s21c1
Sequence:CCGGATAGTTGTGGTACGGTCTAAACTCGAGTTTAGACCGTACCACAACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006352.3-1367s21c1
Sequence:CCGGAGAGTGATGTTGGCACTAATGCTCGAGCATTAGTGCCAACATCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006352.3-1770s21c1
Sequence:CCGGGAAGACTTTCTCTTGCATGTACTCGAGTACATGCAAGAGAAAGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006352.3-710s21c1
Sequence:CCGGTTCATCTGAACAGCGACATTGCTCGAGCAATGTCGCTGTTCAGATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006352.3-830s21c1
Sequence:CCGGATCTCCACATGTATGACATTGCTCGAGCAATGTCATACATGTGGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_006352.3-2069s1c1
Sequence:CCGGGCTCTCAAGAACTTTGGAAATCTCGAGATTTCCAAAGTTCTTGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_006352.3-784s1c1
Sequence:CCGGCAGTTCAAAGACTTGCCCATTCTCGAGAATGGGCAAGTCTTTGAACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006352.3-1428s1c1
Sequence:CCGGCACTAATAACAGGGTACAGTACTCGAGTACTGTACCCTGTTATTAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006352.3-1770s1c1
Sequence:CCGGGAAGACTTTCTCTTGCATGTACTCGAGTACATGCAAGAGAAAGTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_006352.3-922s1c1
Sequence:CCGGGCTTCAAGTTGTTCGGACAAACTCGAGTTTGTCCGAACAACTTGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013915
VALIDATED
ZBTB18 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 18
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000240793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013915.3-2127s21c1
Sequence:CCGGAGAGTGATGTTGGCACTAATGCTCGAGCATTAGTGCCAACATCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_013915.3-1682s1c1
Sequence:CCGGGCTTCAAGTTGTTCGGATAAACTCGAGTTTATCCGAACAACTTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013915.3-2232s21c1
Sequence:CCGGTGAGGGAGGACTCGGTCTTAACTCGAGTTAAGACCGAGTCCTCCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013915.3-1572s21c1
Sequence:CCGGTGCTAGCAGCTGCCAGTTATCCTCGAGGATAACTGGCAGCTGCTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013915.3-1761s21c1
Sequence:CCGGATGAAGGCGAAGATGACAAATCTCGAGATTTGTCATCTTCGCCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240794    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013915.3-4432s21c1
Sequence:CCGGTACTGTAAACATAGCCTATTTCTCGAGAAATAGGCTATGTTTACAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_013915.1-2761s1c1
Sequence:CCGGGTGAACTCCTTGTCGGTCAAACTCGAGTTTGACCGACAAGGAGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_013915.1-1606s1c1
Sequence:CCGGGACATTGTCAAAGTCTGCAAACTCGAGTTTGCAGACTTTGACAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_013915.1-2279s1c1
Sequence:CCGGCCAGCGATGATGAGATGATGACTCGAGTCATCATCTCATCATCGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013915
VALIDATED
ZBTB18 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 18
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000240793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013915.3-2127s21c1
Sequence:CCGGAGAGTGATGTTGGCACTAATGCTCGAGCATTAGTGCCAACATCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_013915.3-1682s1c1
Sequence:CCGGGCTTCAAGTTGTTCGGATAAACTCGAGTTTATCCGAACAACTTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013915.3-2232s21c1
Sequence:CCGGTGAGGGAGGACTCGGTCTTAACTCGAGTTAAGACCGAGTCCTCCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013915.3-1572s21c1
Sequence:CCGGTGCTAGCAGCTGCCAGTTATCCTCGAGGATAACTGGCAGCTGCTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013915.3-1761s21c1
Sequence:CCGGATGAAGGCGAAGATGACAAATCTCGAGATTTGTCATCTTCGCCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240794    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013915.3-4432s21c1
Sequence:CCGGTACTGTAAACATAGCCTATTTCTCGAGAAATAGGCTATGTTTACAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_013915.1-2761s1c1
Sequence:CCGGGTGAACTCCTTGTCGGTCAAACTCGAGTTTGACCGACAAGGAGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_013915.1-1606s1c1
Sequence:CCGGGACATTGTCAAAGTCTGCAAACTCGAGTTTGCAGACTTTGACAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_013915.1-2279s1c1
Sequence:CCGGCCAGCGATGATGAGATGATGACTCGAGTCATCATCTCATCATCGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013915
VALIDATED
ZBTB18 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 18
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000240793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013915.3-2127s21c1
Sequence:CCGGAGAGTGATGTTGGCACTAATGCTCGAGCATTAGTGCCAACATCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_013915.3-1682s1c1
Sequence:CCGGGCTTCAAGTTGTTCGGATAAACTCGAGTTTATCCGAACAACTTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013915.3-2232s21c1
Sequence:CCGGTGAGGGAGGACTCGGTCTTAACTCGAGTTAAGACCGAGTCCTCCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013915.3-1572s21c1
Sequence:CCGGTGCTAGCAGCTGCCAGTTATCCTCGAGGATAACTGGCAGCTGCTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013915.3-1761s21c1
Sequence:CCGGATGAAGGCGAAGATGACAAATCTCGAGATTTGTCATCTTCGCCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240794    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013915.3-4432s21c1
Sequence:CCGGTACTGTAAACATAGCCTATTTCTCGAGAAATAGGCTATGTTTACAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_013915.1-2761s1c1
Sequence:CCGGGTGAACTCCTTGTCGGTCAAACTCGAGTTTGACCGACAAGGAGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_013915.1-1606s1c1
Sequence:CCGGGACATTGTCAAAGTCTGCAAACTCGAGTTTGCAGACTTTGACAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_013915.1-2279s1c1
Sequence:CCGGCCAGCGATGATGAGATGATGACTCGAGTCATCATCTCATCATCGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks