EMAIL THIS PAGE TO A FRIEND

ZBTB1

zinc finger and BTB domain containing 1

Synonyms: ZNF909
UniProtKB ID: Q9Y2K1, A8K6S8, Q86SW8
Gene ID:
Mouse(268564) zinc finger and BTB domain containing 1
Rat(314246) zinc finger and BTB domain containing 1
Zebrafish(407718) zinc finger and BTB domain containing 1
chicken(428916) zinc finger and BTB domain containing 1
Horse(100052254) zinc finger and BTB domain containing 1
domestic cat(101087583) zinc finger and BTB domain containing 1
dog(490731) zinc finger and BTB domain containing 1
domestic guinea pig(100713112) zinc finger and BTB domain containing 1
naked mole-rat(101701768) zinc finger and BTB domain containing 1
Domestic Rabbit(100352705) zinc finger and BTB domain containing 1
cow(526903) zinc finger and BTB domain containing 1
sheep(101109805) zinc finger and BTB domain containing 1
115 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178744 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178744 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178744 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_375086 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_375086 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_375086 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001123329 Rosetta Predictions human pricing
NM_014950 Rosetta Predictions human pricing
NM_001004444 Rosetta Predictions rat pricing
XM_579137 Rosetta Predictions rat pricing
NM_178744 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001123329 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327775 predicted 1919
2 SASI_Hs02_00327776 predicted 1105
3 SASI_Hs02_00327777 predicted 1869
4 SASI_Hs02_00327778 predicted 573
5 SASI_Hs02_00327779 predicted 1121
6 SASI_Hs02_00327780 predicted 1133
7 SASI_Hs02_00327781 predicted 1930
8 SASI_Hs02_00327782 predicted 977
9 SASI_Hs02_00327783 predicted 737
10 SASI_Hs02_00327784 predicted 2051
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014950 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00346627 predicted 1918
2 SASI_Hs01_00210429 predicted 1106
3 SASI_Hs01_00210430 predicted 1870
4 SASI_Hs02_00346628 predicted 570
5 SASI_Hs01_00210431 predicted 1128
6 SASI_Hs01_00210432 predicted 1131
7 SASI_Hs01_00210434 predicted 1935
8 SASI_Hs02_00346629 predicted 981
9 SASI_Hs01_00210435 predicted 739
10 SASI_Hs01_00210437 predicted 2052
11 SASI_Hs01_00210433 predicted 853
12 SASI_Hs01_00210436 predicted 758
13 SASI_Hs01_00210438 predicted 1629
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004444 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041765 predicted 2202
2 SASI_Rn01_00041766 predicted 239
3 SASI_Rn01_00041767 predicted 1956
4 SASI_Rn01_00041768 predicted 552
5 SASI_Rn01_00041769 predicted 2102
6 SASI_Rn01_00041770 predicted 1982
7 SASI_Rn02_00198347 predicted 2063
8 SASI_Rn01_00041771 predicted 1787
9 SASI_Rn01_00041772 predicted 1897
10 SASI_Rn01_00041773 predicted 1047
11 SASI_Rn01_00041764 predicted 1763
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579137 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00156992 predicted 1767
2 SASI_Rn01_00156993 predicted 2208
3 SASI_Rn01_00156994 predicted 250
4 SASI_Rn01_00156995 predicted 1958
5 SASI_Rn01_00156996 predicted 557
6 SASI_Rn01_00156997 predicted 2105
7 SASI_Rn01_00156998 predicted 1985
8 SASI_Rn01_00156999 predicted 1795
9 SASI_Rn01_00157000 predicted 1908
10 SASI_Rn01_00157001 predicted 1053
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178744 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00048463 predicted 1225
2 SASI_Mm01_00048465 predicted 1544
3 SASI_Mm01_00048466 predicted 644
4 SASI_Mm01_00048467 predicted 2268
5 SASI_Mm01_00048468 predicted 2375
6 SASI_Mm01_00048470 predicted 1906
7 SASI_Mm01_00048471 predicted 2247
8 SASI_Mm02_00349281 predicted 1976
9 SASI_Mm02_00349282 predicted 1275
10 SASI_Mm01_00048472 predicted 2631
11 SASI_Mm01_00048464 predicted 2491
12 SASI_Mm01_00048469 predicted 2547
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178744
ZBTB1 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 1
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423926    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178744.2-3014s21c1
Sequence:CCGGTTGACCACTCCTGCTTAAATTCTCGAGAATTTAAGCAGGAGTGGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178744.1-2341s21c1
Sequence:CCGGGTTGCGTCTACACAATGATATCTCGAGATATCATTGTGTAGACGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178744.1-966s21c1
Sequence:CCGGAGCCCAGTTCAACGGTGAATACTCGAGTATTCACCGTTGAACTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178744.1-609s21c1
Sequence:CCGGCTGCCTGTAGCTCCTACTTTACTCGAGTAAAGTAGGAGCTACAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178744.1-2577s21c1
Sequence:CCGGAGGATATGAGATCGCATTATACTCGAGTATAATGCGATCTCATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178744.1-1232s21c1
Sequence:CCGGTACCACCGAATAGTAGATATTCTCGAGAATATCTACTATTCGGTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178744.1-1110s21c1
Sequence:CCGGGACGCTTTGGACGGAGCTTTACTCGAGTAAAGCTCCGTCCAAAGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374358    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178744.1-2864s21c1
Sequence:CCGGTAGACTGTAAGTGGCTATTATCTCGAGATAATAGCCACTTACAGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084478    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178744.1-2956s1c1
Sequence:CCGGGCTGTTTCTATGTACTTTCATCTCGAGATGAAAGTACATAGAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178744.1-1042s1c1
Sequence:CCGGGCCGCTGTTTGATGTGTGTAACTCGAGTTACACACATCAAACAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178744.1-2589s1c1
Sequence:CCGGCGCATTATAATGCCAAGCATTCTCGAGAATGCTTGGCATTATAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178744.1-766s1c1
Sequence:CCGGGCAGTTCAAAGTGGCAATGAACTCGAGTTCATTGCCACTTTGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178744.1-1043s1c1
Sequence:CCGGCCGCTGTTTGATGTGTGTAAACTCGAGTTTACACACATCAAACAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178744
ZBTB1 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 1
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423926    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178744.2-3014s21c1
Sequence:CCGGTTGACCACTCCTGCTTAAATTCTCGAGAATTTAAGCAGGAGTGGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178744.1-2341s21c1
Sequence:CCGGGTTGCGTCTACACAATGATATCTCGAGATATCATTGTGTAGACGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178744.1-966s21c1
Sequence:CCGGAGCCCAGTTCAACGGTGAATACTCGAGTATTCACCGTTGAACTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178744.1-609s21c1
Sequence:CCGGCTGCCTGTAGCTCCTACTTTACTCGAGTAAAGTAGGAGCTACAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178744.1-2577s21c1
Sequence:CCGGAGGATATGAGATCGCATTATACTCGAGTATAATGCGATCTCATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178744.1-1232s21c1
Sequence:CCGGTACCACCGAATAGTAGATATTCTCGAGAATATCTACTATTCGGTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178744.1-1110s21c1
Sequence:CCGGGACGCTTTGGACGGAGCTTTACTCGAGTAAAGCTCCGTCCAAAGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374358    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178744.1-2864s21c1
Sequence:CCGGTAGACTGTAAGTGGCTATTATCTCGAGATAATAGCCACTTACAGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084478    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178744.1-2956s1c1
Sequence:CCGGGCTGTTTCTATGTACTTTCATCTCGAGATGAAAGTACATAGAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178744.1-1042s1c1
Sequence:CCGGGCCGCTGTTTGATGTGTGTAACTCGAGTTACACACATCAAACAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178744.1-2589s1c1
Sequence:CCGGCGCATTATAATGCCAAGCATTCTCGAGAATGCTTGGCATTATAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178744.1-766s1c1
Sequence:CCGGGCAGTTCAAAGTGGCAATGAACTCGAGTTCATTGCCACTTTGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178744.1-1043s1c1
Sequence:CCGGCCGCTGTTTGATGTGTGTAAACTCGAGTTTACACACATCAAACAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178744
ZBTB1 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 1
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423926    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178744.2-3014s21c1
Sequence:CCGGTTGACCACTCCTGCTTAAATTCTCGAGAATTTAAGCAGGAGTGGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178744.1-2341s21c1
Sequence:CCGGGTTGCGTCTACACAATGATATCTCGAGATATCATTGTGTAGACGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178744.1-966s21c1
Sequence:CCGGAGCCCAGTTCAACGGTGAATACTCGAGTATTCACCGTTGAACTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178744.1-609s21c1
Sequence:CCGGCTGCCTGTAGCTCCTACTTTACTCGAGTAAAGTAGGAGCTACAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178744.1-2577s21c1
Sequence:CCGGAGGATATGAGATCGCATTATACTCGAGTATAATGCGATCTCATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178744.1-1232s21c1
Sequence:CCGGTACCACCGAATAGTAGATATTCTCGAGAATATCTACTATTCGGTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178744.1-1110s21c1
Sequence:CCGGGACGCTTTGGACGGAGCTTTACTCGAGTAAAGCTCCGTCCAAAGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374358    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178744.1-2864s21c1
Sequence:CCGGTAGACTGTAAGTGGCTATTATCTCGAGATAATAGCCACTTACAGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084478    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178744.1-2956s1c1
Sequence:CCGGGCTGTTTCTATGTACTTTCATCTCGAGATGAAAGTACATAGAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178744.1-1042s1c1
Sequence:CCGGGCCGCTGTTTGATGTGTGTAACTCGAGTTACACACATCAAACAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178744.1-2589s1c1
Sequence:CCGGCGCATTATAATGCCAAGCATTCTCGAGAATGCTTGGCATTATAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178744.1-766s1c1
Sequence:CCGGGCAGTTCAAAGTGGCAATGAACTCGAGTTCATTGCCACTTTGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178744.1-1043s1c1
Sequence:CCGGCCGCTGTTTGATGTGTGTAAACTCGAGTTTACACACATCAAACAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_375086
VALIDATED
ZBTB1 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375086.1-1879s1c1
Sequence:CCGGGCAGTCCGAAATAAGAGATATCTCGAGATATCTCTTATTTCGGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375086.1-689s1c1
Sequence:CCGGGCAATGAACTACCTACAGCTACTCGAGTAGCTGTAGGTAGTTCATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:XM_375086.1-1736s1c1
Sequence:CCGGGCATGTGGTAAATGTGGACAACTCGAGTTGTCCACATTTACCACATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375086.1-888s1c1
Sequence:CCGGCGGTAAATACACCACATAATACTCGAGTATTATGTGGTGTATTTACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375086.1-2302s1c1
Sequence:CCGGGCCTTCTAAACCTGTGGAGAACTCGAGTTCTCCACAGGTTTAGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_375086
VALIDATED
ZBTB1 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375086.1-1879s1c1
Sequence:CCGGGCAGTCCGAAATAAGAGATATCTCGAGATATCTCTTATTTCGGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375086.1-689s1c1
Sequence:CCGGGCAATGAACTACCTACAGCTACTCGAGTAGCTGTAGGTAGTTCATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:XM_375086.1-1736s1c1
Sequence:CCGGGCATGTGGTAAATGTGGACAACTCGAGTTGTCCACATTTACCACATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375086.1-888s1c1
Sequence:CCGGCGGTAAATACACCACATAATACTCGAGTATTATGTGGTGTATTTACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375086.1-2302s1c1
Sequence:CCGGGCCTTCTAAACCTGTGGAGAACTCGAGTTCTCCACAGGTTTAGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_375086
VALIDATED
ZBTB1 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375086.1-1879s1c1
Sequence:CCGGGCAGTCCGAAATAAGAGATATCTCGAGATATCTCTTATTTCGGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375086.1-689s1c1
Sequence:CCGGGCAATGAACTACCTACAGCTACTCGAGTAGCTGTAGGTAGTTCATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:XM_375086.1-1736s1c1
Sequence:CCGGGCATGTGGTAAATGTGGACAACTCGAGTTGTCCACATTTACCACATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375086.1-888s1c1
Sequence:CCGGCGGTAAATACACCACATAATACTCGAGTATTATGTGGTGTATTTACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375086.1-2302s1c1
Sequence:CCGGGCCTTCTAAACCTGTGGAGAACTCGAGTTCTCCACAGGTTTAGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks