EMAIL THIS PAGE TO A FRIEND

ZBTB20

zinc finger and BTB domain containing 20

Synonyms: DPZF HOF ODA-8S ZNF288
UniProtKB ID: Q9HC78, Q63HP6, Q8N6R5, Q9Y410
Gene ID:
Mouse(56490) zinc finger and BTB domain containing 20
Rat(288105) zinc finger and BTB domain containing 20
cow(508864) zinc finger and BTB domain containing 20
sheep(101116796) zinc finger and BTB domain containing 20
naked mole-rat(101710846) zinc finger and BTB domain containing 20
domestic guinea pig(100716912) zinc finger and BTB domain containing 20
Zebrafish(568779) zinc finger and BTB domain containing 20
chicken(418349) zinc finger and BTB domain containing 20
Horse(100071295) zinc finger and BTB domain containing 20
domestic cat(101093386) zinc finger and BTB domain containing 20
dog(487987) zinc finger and BTB domain containing 20
77 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019778 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019778 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019778 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015642 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015642 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015642 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015642 Rosetta Predictions human pricing
NM_001105880 Rosetta Predictions rat pricing
NM_019778 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015642 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131675 predicted 637
2 SASI_Hs01_00131676 predicted 2293
3 SASI_Hs01_00131677 predicted 2246
4 SASI_Hs01_00131678 predicted 1823
5 SASI_Hs01_00131679 predicted 1758
6 SASI_Hs01_00131680 predicted 1712
7 SASI_Hs01_00131681 predicted 2129
8 SASI_Hs01_00131683 predicted 983
9 SASI_Hs02_00348249 predicted 1881
10 SASI_Hs02_00348250 predicted 1135
11 SASI_Hs01_00131682 predicted 968
12 SASI_Hs01_00131684 predicted 1674
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105880 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213442 predicted 2013
2 SASI_Rn02_00213443 predicted 1133
3 SASI_Rn02_00213444 predicted 919
4 SASI_Rn02_00213445 predicted 1718
5 SASI_Rn02_00213446 predicted 2024
6 SASI_Rn02_00213447 predicted 2117
7 SASI_Rn02_00213448 predicted 1671
8 SASI_Rn02_00213449 predicted 2540
9 SASI_Rn02_00213450 predicted 2406
10 SASI_Rn02_00213451 predicted 2091
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019778 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00195395 predicted 1681
2 SASI_Mm01_00195396 predicted 592
3 SASI_Mm01_00195397 predicted 1332
4 SASI_Mm01_00195398 predicted 1788
5 SASI_Mm01_00195399 predicted 934
6 SASI_Mm01_00195400 predicted 1391
7 SASI_Mm01_00195401 predicted 1846
8 SASI_Mm01_00195402 predicted 2081
9 SASI_Mm01_00195403 predicted 1768
10 SASI_Mm01_00195404 predicted 1350
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019778
VALIDATED
ZBTB20 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 20
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000312848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019778.1-1699s21c1
Sequence:CCGGTGTCAGTAACAGCTCCGATAACTCGAGTTATCGGAGCTGTTACTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312851    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019778.1-2662s21c1
Sequence:CCGGAGCTATGGCACTAGAATTTAACTCGAGTTAAATTCTAGTGCCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019778.1-1394s21c1
Sequence:CCGGCAGATCCTAGAACGCAATGAACTCGAGTTCATTGCGTTCTAGGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019778.1-1735s21c1
Sequence:CCGGGCCTTCAGTCAACACATCCATCTCGAGATGGATGTGTTGACTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019778.1-763s21c1
Sequence:CCGGGGGCTACAGCGACATCGAAATCTCGAGATTTCGATGTCGCTGTAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086328    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019778.1-2763s1c1
Sequence:CCGGGCCTGCTGGTACATTACATTTCTCGAGAAATGTAATGTACCAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019778.1-2517s1c1
Sequence:CCGGGCCCAGCAAAGTTTGACCAAACTCGAGTTTGGTCAAACTTTGCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019778.1-544s1c1
Sequence:CCGGCGGGTCATCTGATTGTGACATCTCGAGATGTCACAATCAGATGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019778.1-1394s1c1
Sequence:CCGGCAGATCCTAGAACGCAATGAACTCGAGTTCATTGCGTTCTAGGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019778.1-1735s1c1
Sequence:CCGGGCCTTCAGTCAACACATCCATCTCGAGATGGATGTGTTGACTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019778
VALIDATED
ZBTB20 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 20
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000312848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019778.1-1699s21c1
Sequence:CCGGTGTCAGTAACAGCTCCGATAACTCGAGTTATCGGAGCTGTTACTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312851    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019778.1-2662s21c1
Sequence:CCGGAGCTATGGCACTAGAATTTAACTCGAGTTAAATTCTAGTGCCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019778.1-1394s21c1
Sequence:CCGGCAGATCCTAGAACGCAATGAACTCGAGTTCATTGCGTTCTAGGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019778.1-1735s21c1
Sequence:CCGGGCCTTCAGTCAACACATCCATCTCGAGATGGATGTGTTGACTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019778.1-763s21c1
Sequence:CCGGGGGCTACAGCGACATCGAAATCTCGAGATTTCGATGTCGCTGTAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086328    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019778.1-2763s1c1
Sequence:CCGGGCCTGCTGGTACATTACATTTCTCGAGAAATGTAATGTACCAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019778.1-2517s1c1
Sequence:CCGGGCCCAGCAAAGTTTGACCAAACTCGAGTTTGGTCAAACTTTGCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019778.1-544s1c1
Sequence:CCGGCGGGTCATCTGATTGTGACATCTCGAGATGTCACAATCAGATGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019778.1-1394s1c1
Sequence:CCGGCAGATCCTAGAACGCAATGAACTCGAGTTCATTGCGTTCTAGGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019778.1-1735s1c1
Sequence:CCGGGCCTTCAGTCAACACATCCATCTCGAGATGGATGTGTTGACTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019778
VALIDATED
ZBTB20 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 20
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000312848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019778.1-1699s21c1
Sequence:CCGGTGTCAGTAACAGCTCCGATAACTCGAGTTATCGGAGCTGTTACTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312851    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019778.1-2662s21c1
Sequence:CCGGAGCTATGGCACTAGAATTTAACTCGAGTTAAATTCTAGTGCCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019778.1-1394s21c1
Sequence:CCGGCAGATCCTAGAACGCAATGAACTCGAGTTCATTGCGTTCTAGGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019778.1-1735s21c1
Sequence:CCGGGCCTTCAGTCAACACATCCATCTCGAGATGGATGTGTTGACTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019778.1-763s21c1
Sequence:CCGGGGGCTACAGCGACATCGAAATCTCGAGATTTCGATGTCGCTGTAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086328    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019778.1-2763s1c1
Sequence:CCGGGCCTGCTGGTACATTACATTTCTCGAGAAATGTAATGTACCAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019778.1-2517s1c1
Sequence:CCGGGCCCAGCAAAGTTTGACCAAACTCGAGTTTGGTCAAACTTTGCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019778.1-544s1c1
Sequence:CCGGCGGGTCATCTGATTGTGACATCTCGAGATGTCACAATCAGATGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019778.1-1394s1c1
Sequence:CCGGCAGATCCTAGAACGCAATGAACTCGAGTTCATTGCGTTCTAGGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019778.1-1735s1c1
Sequence:CCGGGCCTTCAGTCAACACATCCATCTCGAGATGGATGTGTTGACTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015642
ZBTB20 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 20
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015642.1-2429s1c1
Sequence:CCGGCCCAGCAAAGTTTGACCAAATCTCGAGATTTGGTCAAACTTTGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015642.1-1598s1c1
Sequence:CCGGCACTGTTATCACTGTCAGCAACTCGAGTTGCTGACAGTGATAACAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015642.1-2106s1c1
Sequence:CCGGCGCTCCTTCTCCTTAAAGGATCTCGAGATCCTTTAAGGAGAAGGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015642.1-2171s1c1
Sequence:CCGGCCAGTGTAGTATCTGCAACAACTCGAGTTGTTGCAGATACTACACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015642.1-1531s1c1
Sequence:CCGGCGCAGACAAACCAGCTAGAAACTCGAGTTTCTAGCTGGTTTGTCTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015642
ZBTB20 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 20
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015642.1-2429s1c1
Sequence:CCGGCCCAGCAAAGTTTGACCAAATCTCGAGATTTGGTCAAACTTTGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015642.1-1598s1c1
Sequence:CCGGCACTGTTATCACTGTCAGCAACTCGAGTTGCTGACAGTGATAACAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015642.1-2106s1c1
Sequence:CCGGCGCTCCTTCTCCTTAAAGGATCTCGAGATCCTTTAAGGAGAAGGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015642.1-2171s1c1
Sequence:CCGGCCAGTGTAGTATCTGCAACAACTCGAGTTGTTGCAGATACTACACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015642.1-1531s1c1
Sequence:CCGGCGCAGACAAACCAGCTAGAAACTCGAGTTTCTAGCTGGTTTGTCTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015642
ZBTB20 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 20
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015642.1-2429s1c1
Sequence:CCGGCCCAGCAAAGTTTGACCAAATCTCGAGATTTGGTCAAACTTTGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015642.1-1598s1c1
Sequence:CCGGCACTGTTATCACTGTCAGCAACTCGAGTTGCTGACAGTGATAACAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015642.1-2106s1c1
Sequence:CCGGCGCTCCTTCTCCTTAAAGGATCTCGAGATCCTTTAAGGAGAAGGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015642.1-2171s1c1
Sequence:CCGGCCAGTGTAGTATCTGCAACAACTCGAGTTGTTGCAGATACTACACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015642.1-1531s1c1
Sequence:CCGGCGCAGACAAACCAGCTAGAAACTCGAGTTTCTAGCTGGTTTGTCTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks