EMAIL THIS PAGE TO A FRIEND

ZBTB21

zinc finger and BTB domain containing 21

Synonyms: ZNF295
Species: Human ZBTB21(49854), Mouse Zbtb21(114565), Zebrafish zbtb21(566813), domestic guinea pig Zbtb21(100721680), naked mole-rat Zbtb21(101712936)
UniProtKB ID: Q9ULJ3, Q5R2W1, Q5R2W2, Q6P4R0
Gene ID:
Mouse(114565) zinc finger and BTB domain containing 21
Zebrafish(566813) zinc finger and BTB domain containing 21
domestic guinea pig(100721680) zinc finger and BTB domain containing 21
naked mole-rat(101712936) zinc finger and BTB domain containing 21
131 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175428 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175428 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175428 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020727 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020727 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020727 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098402 Rosetta Predictions human pricing
NM_001098403 Rosetta Predictions human pricing
NM_020727 Rosetta Predictions human pricing
NM_001081684 Rosetta Predictions mouse pricing
NM_001081685 Rosetta Predictions mouse pricing
NM_175428 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098402 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318798 predicted 3387
2 SASI_Hs02_00318799 predicted 1095
3 SASI_Hs02_00318800 predicted 1057
4 SASI_Hs02_00318801 predicted 511
5 SASI_Hs02_00318802 predicted 412
6 SASI_Hs02_00318803 predicted 1391
7 SASI_Hs02_00318804 predicted 3378
8 SASI_Hs02_00318805 predicted 1149
9 SASI_Hs02_00318806 predicted 1196
10 SASI_Hs02_00318807 predicted 2813
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098403 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318808 predicted 2784
2 SASI_Hs02_00318809 predicted 1088
3 SASI_Hs02_00318810 predicted 1058
4 SASI_Hs02_00318811 predicted 511
5 SASI_Hs02_00318812 predicted 408
6 SASI_Hs02_00318813 predicted 1395
7 SASI_Hs02_00318814 predicted 2772
8 SASI_Hs02_00318815 predicted 1152
9 SASI_Hs02_00318816 predicted 1197
10 SASI_Hs02_00318817 predicted 2203
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020727 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153435 predicted 3323
2 SASI_Hs01_00153436 predicted 1026
3 SASI_Hs02_00353790 predicted 993
4 SASI_Hs01_00153439 predicted 447
5 SASI_Hs01_00153441 predicted 343
6 SASI_Hs02_00353791 predicted 1324
7 SASI_Hs02_00353792 predicted 3314
8 SASI_Hs01_00153442 predicted 1087
9 SASI_Hs02_00353793 predicted 1129
10 SASI_Hs02_00353794 predicted 2749
11 SASI_Hs01_00153437 predicted 2151
12 SASI_Hs01_00153438 predicted 1843
13 SASI_Hs01_00153440 predicted 1488
14 SASI_Hs01_00153443 predicted 2503
15 SASI_Hs01_00153444 predicted 1389
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081684 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298995 predicted 1125
2 SASI_Mm02_00298996 predicted 1013
3 SASI_Mm02_00298997 predicted 3287
4 SASI_Mm02_00298998 predicted 683
5 SASI_Mm02_00298999 predicted 3119
6 SASI_Mm02_00299000 predicted 1055
7 SASI_Mm02_00299001 predicted 463
8 SASI_Mm02_00299002 predicted 2960
9 SASI_Mm02_00299003 predicted 1012
10 SASI_Mm02_00299004 predicted 664
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081685 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299005 predicted 1268
2 SASI_Mm02_00299006 predicted 1160
3 SASI_Mm02_00299007 predicted 2829
4 SASI_Mm02_00299008 predicted 822
5 SASI_Mm02_00299009 predicted 2662
6 SASI_Mm02_00299010 predicted 1201
7 SASI_Mm02_00299011 predicted 601
8 SASI_Mm02_00299012 predicted 2497
9 SASI_Mm02_00299013 predicted 1155
10 SASI_Mm02_00299014 predicted 805
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175428 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00194399 predicted 1266
2 SASI_Mm01_00194401 predicted 1152
3 SASI_Mm02_00346301 predicted 3431
4 SASI_Mm01_00194403 predicted 820
5 SASI_Mm02_00346302 predicted 3258
6 SASI_Mm02_00346303 predicted 1204
7 SASI_Mm02_00346304 predicted 606
8 SASI_Mm01_00194406 predicted 3105
9 SASI_Mm02_00346305 predicted 1159
10 SASI_Mm01_00194408 predicted 807
11 SASI_Mm01_00194400 predicted 2620
12 SASI_Mm01_00194402 predicted 2019
13 SASI_Mm01_00194404 predicted 2428
14 SASI_Mm01_00194405 predicted 2199
15 SASI_Mm01_00194407 predicted 2058
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175428
VALIDATED
ZBTB21 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 21
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175428.2-487s1c1
Sequence:CCGGCCGAGCTCATAAGAACGTCTTCTCGAGAAGACGTTCTTATGAGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175428.2-2338s1c1
Sequence:CCGGGCAAGTCATCAAGAGGAACTTCTCGAGAAGTTCCTCTTGATGACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175428.2-3181s1c1
Sequence:CCGGCCACGTATGCTACAAAGCCTTCTCGAGAAGGCTTTGTAGCATACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081618    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175428.2-3402s1c1
Sequence:CCGGCCAGCTACAGAGAAGCTGTTTCTCGAGAAACAGCTTCTCTGTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175428.2-2061s1c1
Sequence:CCGGGCCATGTTAACATGTACCATACTCGAGTATGGTACATGTTAACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175428.3-3400s21c1
Sequence:CCGGCCAGCTACAGAGAAGCTGTTTCTCGAGAAACAGCTTCTCTGTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175428.3-486s21c1
Sequence:CCGGCCGAGCTCATAAGAACGTCTTCTCGAGAAGACGTTCTTATGAGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175428.3-2337s21c1
Sequence:CCGGGCAAGTCATCAAGAGGAACTTCTCGAGAAGTTCCTCTTGATGACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175428.3-3180s21c1
Sequence:CCGGCCACGTATGCTACAAAGCCTTCTCGAGAAGGCTTTGTAGCATACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175428
VALIDATED
ZBTB21 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 21
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175428.2-487s1c1
Sequence:CCGGCCGAGCTCATAAGAACGTCTTCTCGAGAAGACGTTCTTATGAGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175428.2-2338s1c1
Sequence:CCGGGCAAGTCATCAAGAGGAACTTCTCGAGAAGTTCCTCTTGATGACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175428.2-3181s1c1
Sequence:CCGGCCACGTATGCTACAAAGCCTTCTCGAGAAGGCTTTGTAGCATACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081618    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175428.2-3402s1c1
Sequence:CCGGCCAGCTACAGAGAAGCTGTTTCTCGAGAAACAGCTTCTCTGTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175428.2-2061s1c1
Sequence:CCGGGCCATGTTAACATGTACCATACTCGAGTATGGTACATGTTAACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175428.3-3400s21c1
Sequence:CCGGCCAGCTACAGAGAAGCTGTTTCTCGAGAAACAGCTTCTCTGTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175428.3-486s21c1
Sequence:CCGGCCGAGCTCATAAGAACGTCTTCTCGAGAAGACGTTCTTATGAGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175428.3-2337s21c1
Sequence:CCGGGCAAGTCATCAAGAGGAACTTCTCGAGAAGTTCCTCTTGATGACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175428.3-3180s21c1
Sequence:CCGGCCACGTATGCTACAAAGCCTTCTCGAGAAGGCTTTGTAGCATACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175428
VALIDATED
ZBTB21 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 21
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175428.2-487s1c1
Sequence:CCGGCCGAGCTCATAAGAACGTCTTCTCGAGAAGACGTTCTTATGAGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175428.2-2338s1c1
Sequence:CCGGGCAAGTCATCAAGAGGAACTTCTCGAGAAGTTCCTCTTGATGACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175428.2-3181s1c1
Sequence:CCGGCCACGTATGCTACAAAGCCTTCTCGAGAAGGCTTTGTAGCATACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081618    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175428.2-3402s1c1
Sequence:CCGGCCAGCTACAGAGAAGCTGTTTCTCGAGAAACAGCTTCTCTGTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175428.2-2061s1c1
Sequence:CCGGGCCATGTTAACATGTACCATACTCGAGTATGGTACATGTTAACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175428.3-3400s21c1
Sequence:CCGGCCAGCTACAGAGAAGCTGTTTCTCGAGAAACAGCTTCTCTGTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175428.3-486s21c1
Sequence:CCGGCCGAGCTCATAAGAACGTCTTCTCGAGAAGACGTTCTTATGAGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175428.3-2337s21c1
Sequence:CCGGGCAAGTCATCAAGAGGAACTTCTCGAGAAGTTCCTCTTGATGACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175428.3-3180s21c1
Sequence:CCGGCCACGTATGCTACAAAGCCTTCTCGAGAAGGCTTTGTAGCATACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020727
VALIDATED
ZBTB21 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 21
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_020727.2-2408s1c1
Sequence:CCGGCGAGAGCAAGTGTGAGTATAACTCGAGTTATACTCACACTTGCTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_020727.2-262s1c1
Sequence:CCGGGCAGCGAATACTTTCAGAGTTCTCGAGAACTCTGAAAGTATTCGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020727.2-1835s1c1
Sequence:CCGGCGCTTGTGACATCTGTCACAACTCGAGTTGTGACAGATGTCACAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_020727.2-445s1c1
Sequence:CCGGCCTTTCTGACTAACATCGTTTCTCGAGAAACGATGTTAGTCAGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_020727.2-3172s1c1
Sequence:CCGGCCCAAGAATCAGACACCCTTTCTCGAGAAAGGGTGTCTGATTCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235882    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020727.4-6264s21c1
Sequence:CCGGGTTTGGAATGGAACGTTTATACTCGAGTATAAACGTTCCATTCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020727.4-1614s21c1
Sequence:CCGGGACCGAAGATTGCCGTTTAAGCTCGAGCTTAAACGGCAATCTTCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020727.4-1205s21c1
Sequence:CCGGCTATTCACCTTCCATAGATTTCTCGAGAAATCTATGGAAGGTGAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020727.4-692s21c1
Sequence:CCGGAGTCAAGGCCAATACCAATAACTCGAGTTATTGGTATTGGCCTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020727.4-2197s21c1
Sequence:CCGGCTCAATTTAAGCAGCATATAACTCGAGTTATATGCTGCTTAAATTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020727
VALIDATED
ZBTB21 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 21
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_020727.2-2408s1c1
Sequence:CCGGCGAGAGCAAGTGTGAGTATAACTCGAGTTATACTCACACTTGCTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_020727.2-262s1c1
Sequence:CCGGGCAGCGAATACTTTCAGAGTTCTCGAGAACTCTGAAAGTATTCGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020727.2-1835s1c1
Sequence:CCGGCGCTTGTGACATCTGTCACAACTCGAGTTGTGACAGATGTCACAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_020727.2-445s1c1
Sequence:CCGGCCTTTCTGACTAACATCGTTTCTCGAGAAACGATGTTAGTCAGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_020727.2-3172s1c1
Sequence:CCGGCCCAAGAATCAGACACCCTTTCTCGAGAAAGGGTGTCTGATTCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235882    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020727.4-6264s21c1
Sequence:CCGGGTTTGGAATGGAACGTTTATACTCGAGTATAAACGTTCCATTCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020727.4-1614s21c1
Sequence:CCGGGACCGAAGATTGCCGTTTAAGCTCGAGCTTAAACGGCAATCTTCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020727.4-1205s21c1
Sequence:CCGGCTATTCACCTTCCATAGATTTCTCGAGAAATCTATGGAAGGTGAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020727.4-692s21c1
Sequence:CCGGAGTCAAGGCCAATACCAATAACTCGAGTTATTGGTATTGGCCTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020727.4-2197s21c1
Sequence:CCGGCTCAATTTAAGCAGCATATAACTCGAGTTATATGCTGCTTAAATTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020727
VALIDATED
ZBTB21 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 21
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_020727.2-2408s1c1
Sequence:CCGGCGAGAGCAAGTGTGAGTATAACTCGAGTTATACTCACACTTGCTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_020727.2-262s1c1
Sequence:CCGGGCAGCGAATACTTTCAGAGTTCTCGAGAACTCTGAAAGTATTCGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020727.2-1835s1c1
Sequence:CCGGCGCTTGTGACATCTGTCACAACTCGAGTTGTGACAGATGTCACAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_020727.2-445s1c1
Sequence:CCGGCCTTTCTGACTAACATCGTTTCTCGAGAAACGATGTTAGTCAGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_020727.2-3172s1c1
Sequence:CCGGCCCAAGAATCAGACACCCTTTCTCGAGAAAGGGTGTCTGATTCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235882    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020727.4-6264s21c1
Sequence:CCGGGTTTGGAATGGAACGTTTATACTCGAGTATAAACGTTCCATTCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020727.4-1614s21c1
Sequence:CCGGGACCGAAGATTGCCGTTTAAGCTCGAGCTTAAACGGCAATCTTCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020727.4-1205s21c1
Sequence:CCGGCTATTCACCTTCCATAGATTTCTCGAGAAATCTATGGAAGGTGAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020727.4-692s21c1
Sequence:CCGGAGTCAAGGCCAATACCAATAACTCGAGTTATTGGTATTGGCCTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020727.4-2197s21c1
Sequence:CCGGCTCAATTTAAGCAGCATATAACTCGAGTTATATGCTGCTTAAATTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks