EMAIL THIS PAGE TO A FRIEND

ZBTB22

zinc finger and BTB domain containing 22

Synonyms: BING1 ZBTB22A ZNF297 ZNF297A fru fruitless
UniProtKB ID: O15209, B0V007, Q5HYV4, Q5STL0, Q5STR7, Q8WV82
Gene ID:
Mouse(81630) zinc finger and BTB domain containing 22
Rat(309630) zinc finger and BTB domain containing 22
cow(538456) zinc finger and BTB domain containing 22
sheep(101117373) zinc finger and BTB domain containing 22
naked mole-rat(101720280) zinc finger and BTB domain containing 22
domestic guinea pig(100730284) zinc finger and BTB domain containing 22
domestic cat(101089010) zinc finger and BTB domain containing 22
Horse(100052918) zinc finger and BTB domain containing 22
dog(607900) zinc finger and BTB domain containing 22
94 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005453 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005453 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005453 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020625 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020625 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020625 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU027111 MISSION® esiRNA esiRNA targeting mouse Zbtb22 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005453 Rosetta Predictions human pricing
NM_001009172 Rosetta Predictions rat pricing
XM_579277 Rosetta Predictions rat pricing
NM_020625 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005453 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127196 predicted 908
2 SASI_Hs01_00127197 predicted 500
3 SASI_Hs01_00127198 predicted 794
4 SASI_Hs01_00127199 predicted 1269
5 SASI_Hs01_00127200 predicted 1249
6 SASI_Hs01_00127201 predicted 1652
7 SASI_Hs01_00127202 predicted 1003
8 SASI_Hs01_00127203 predicted 995
9 SASI_Hs01_00127204 predicted 2111
10 SASI_Hs02_00339612 predicted 1698
11 SASI_Hs01_00127195 predicted 2126
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009172 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087612 predicted 2126
2 SASI_Rn01_00087613 predicted 561
3 SASI_Rn02_00199489 predicted 1582
4 SASI_Rn01_00087615 predicted 1039
5 SASI_Rn01_00087616 predicted 1271
6 SASI_Rn01_00087617 predicted 408
7 SASI_Rn01_00087618 predicted 1125
8 SASI_Rn01_00087619 predicted 704
9 SASI_Rn01_00087620 predicted 2078
10 SASI_Rn01_00087621 predicted 1689
11 SASI_Rn01_00087614 predicted 755
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579277 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00163020 predicted 2103
2 SASI_Rn01_00163021 predicted 533
3 SASI_Rn01_00163022 predicted 720
4 SASI_Rn01_00163023 predicted 1015
5 SASI_Rn01_00163024 predicted 1254
6 SASI_Rn01_00163025 predicted 380
7 SASI_Rn01_00163026 predicted 1108
8 SASI_Rn01_00163027 predicted 683
9 SASI_Rn01_00163028 predicted 2055
10 SASI_Rn01_00163029 predicted 1666
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020625 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00180251 predicted 575
2 SASI_Mm01_00180252 predicted 1288
3 SASI_Mm01_00180253 predicted 420
4 SASI_Mm01_00180254 predicted 1137
5 SASI_Mm01_00180255 predicted 1053
6 SASI_Mm01_00180256 predicted 393
7 SASI_Mm01_00180257 predicted 2144
8 SASI_Mm01_00180258 predicted 1771
9 SASI_Mm01_00180259 predicted 2163
10 SASI_Mm02_00325767 predicted 2024
11 SASI_Mm01_00180260 predicted 1551
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005453
ZBTB22 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 22
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434842    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005453.4-2251s21c1
Sequence:CCGGCAAGGTATTTCCAGAACTAAACTCGAGTTTAGTTCTGGAAATACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005453.4-1285s21c1
Sequence:CCGGGTGAGTCCTCCAATGACTTTGCTCGAGCAAAGTCATTGGAGGACTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005453.4-400s21c1
Sequence:CCGGATGATCAGGTCCTACTCAAAGCTCGAGCTTTGAGTAGGACCTGATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420302    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005453.4-2306s21c1
Sequence:CCGGCCTGCTCCACAGAGTAGATTGCTCGAGCAATCTACTCTGTGGAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005453.3-2128s1c1
Sequence:CCGGCCACACTTACTGTCTTCCTTTCTCGAGAAAGGAAGACAGTAAGTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005453.3-531s1c1
Sequence:CCGGGTGCTCCAAATGTGGCACATTCTCGAGAATGTGCCACATTTGGAGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005453.3-1009s1c1
Sequence:CCGGTGCCACAGAAACACTGGGTATCTCGAGATACCCAGTGTTTCTGTGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005453.3-561s1c1
Sequence:CCGGTGCACTGAACTACTCCGAGAACTCGAGTTCTCGGAGTAGTTCAGTGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005453.3-1194s1c1
Sequence:CCGGGCTACCCTCAGCATAAGTGATCTCGAGATCACTTATGCTGAGGGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005453
ZBTB22 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 22
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434842    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005453.4-2251s21c1
Sequence:CCGGCAAGGTATTTCCAGAACTAAACTCGAGTTTAGTTCTGGAAATACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005453.4-1285s21c1
Sequence:CCGGGTGAGTCCTCCAATGACTTTGCTCGAGCAAAGTCATTGGAGGACTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005453.4-400s21c1
Sequence:CCGGATGATCAGGTCCTACTCAAAGCTCGAGCTTTGAGTAGGACCTGATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420302    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005453.4-2306s21c1
Sequence:CCGGCCTGCTCCACAGAGTAGATTGCTCGAGCAATCTACTCTGTGGAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005453.3-2128s1c1
Sequence:CCGGCCACACTTACTGTCTTCCTTTCTCGAGAAAGGAAGACAGTAAGTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005453.3-531s1c1
Sequence:CCGGGTGCTCCAAATGTGGCACATTCTCGAGAATGTGCCACATTTGGAGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005453.3-1009s1c1
Sequence:CCGGTGCCACAGAAACACTGGGTATCTCGAGATACCCAGTGTTTCTGTGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005453.3-561s1c1
Sequence:CCGGTGCACTGAACTACTCCGAGAACTCGAGTTCTCGGAGTAGTTCAGTGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005453.3-1194s1c1
Sequence:CCGGGCTACCCTCAGCATAAGTGATCTCGAGATCACTTATGCTGAGGGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005453
ZBTB22 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 22
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434842    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005453.4-2251s21c1
Sequence:CCGGCAAGGTATTTCCAGAACTAAACTCGAGTTTAGTTCTGGAAATACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005453.4-1285s21c1
Sequence:CCGGGTGAGTCCTCCAATGACTTTGCTCGAGCAAAGTCATTGGAGGACTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005453.4-400s21c1
Sequence:CCGGATGATCAGGTCCTACTCAAAGCTCGAGCTTTGAGTAGGACCTGATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420302    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005453.4-2306s21c1
Sequence:CCGGCCTGCTCCACAGAGTAGATTGCTCGAGCAATCTACTCTGTGGAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005453.3-2128s1c1
Sequence:CCGGCCACACTTACTGTCTTCCTTTCTCGAGAAAGGAAGACAGTAAGTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005453.3-531s1c1
Sequence:CCGGGTGCTCCAAATGTGGCACATTCTCGAGAATGTGCCACATTTGGAGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005453.3-1009s1c1
Sequence:CCGGTGCCACAGAAACACTGGGTATCTCGAGATACCCAGTGTTTCTGTGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005453.3-561s1c1
Sequence:CCGGTGCACTGAACTACTCCGAGAACTCGAGTTCTCGGAGTAGTTCAGTGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005453.3-1194s1c1
Sequence:CCGGGCTACCCTCAGCATAAGTGATCTCGAGATCACTTATGCTGAGGGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020625
VALIDATED
ZBTB22 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 22
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000311849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020625.3-1230s21c1
Sequence:CCGGACCCTCAGTATCAGTGATGTTCTCGAGAACATCACTGATACTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312784    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020625.3-2153s21c1
Sequence:CCGGTTACCTCGGTGGACTTGTATACTCGAGTATACAAGTCCACCGAGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020625.3-1586s21c1
Sequence:CCGGAGGCAACAGCGACGGGAATAACTCGAGTTATTCCCGTCGCTGTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020625.3-823s21c1
Sequence:CCGGCTACCTCCCAGGATGCATTTGCTCGAGCAAATGCATCCTGGGAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374273    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020625.3-2369s21c1
Sequence:CCGGCAGTCAGGTTGTGCTAGTTTGCTCGAGCAAACTAGCACAACCTGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020625.3-1300s21c1
Sequence:CCGGGTGAATCCTCCAATGACTTTGCTCGAGCAAAGTCATTGGAGGATTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_020625.2-1063s1c1
Sequence:CCGGCCCGATCTAGAAGATGAGGAACTCGAGTTCCTCATCTTCTAGATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020625.2-1608s1c1
Sequence:CCGGGCACGTGAATATGCATCTCAACTCGAGTTGAGATGCATATTCACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_020625.2-1177s1c1
Sequence:CCGGACCCTCAGTATCAGTGATGTTCTCGAGAACATCACTGATACTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020625.2-991s1c1
Sequence:CCGGCCACAGAAACACTGGGTGTATCTCGAGATACACCCAGTGTTTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020625.2-2082s1c1
Sequence:CCGGCCACCAAACAGTCTTCCCTTACTCGAGTAAGGGAAGACTGTTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020625
VALIDATED
ZBTB22 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 22
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000311849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020625.3-1230s21c1
Sequence:CCGGACCCTCAGTATCAGTGATGTTCTCGAGAACATCACTGATACTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312784    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020625.3-2153s21c1
Sequence:CCGGTTACCTCGGTGGACTTGTATACTCGAGTATACAAGTCCACCGAGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020625.3-1586s21c1
Sequence:CCGGAGGCAACAGCGACGGGAATAACTCGAGTTATTCCCGTCGCTGTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020625.3-823s21c1
Sequence:CCGGCTACCTCCCAGGATGCATTTGCTCGAGCAAATGCATCCTGGGAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374273    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020625.3-2369s21c1
Sequence:CCGGCAGTCAGGTTGTGCTAGTTTGCTCGAGCAAACTAGCACAACCTGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020625.3-1300s21c1
Sequence:CCGGGTGAATCCTCCAATGACTTTGCTCGAGCAAAGTCATTGGAGGATTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_020625.2-1063s1c1
Sequence:CCGGCCCGATCTAGAAGATGAGGAACTCGAGTTCCTCATCTTCTAGATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020625.2-1608s1c1
Sequence:CCGGGCACGTGAATATGCATCTCAACTCGAGTTGAGATGCATATTCACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_020625.2-1177s1c1
Sequence:CCGGACCCTCAGTATCAGTGATGTTCTCGAGAACATCACTGATACTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020625.2-991s1c1
Sequence:CCGGCCACAGAAACACTGGGTGTATCTCGAGATACACCCAGTGTTTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020625.2-2082s1c1
Sequence:CCGGCCACCAAACAGTCTTCCCTTACTCGAGTAAGGGAAGACTGTTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020625
VALIDATED
ZBTB22 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 22
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000311849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020625.3-1230s21c1
Sequence:CCGGACCCTCAGTATCAGTGATGTTCTCGAGAACATCACTGATACTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312784    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020625.3-2153s21c1
Sequence:CCGGTTACCTCGGTGGACTTGTATACTCGAGTATACAAGTCCACCGAGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020625.3-1586s21c1
Sequence:CCGGAGGCAACAGCGACGGGAATAACTCGAGTTATTCCCGTCGCTGTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020625.3-823s21c1
Sequence:CCGGCTACCTCCCAGGATGCATTTGCTCGAGCAAATGCATCCTGGGAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374273    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020625.3-2369s21c1
Sequence:CCGGCAGTCAGGTTGTGCTAGTTTGCTCGAGCAAACTAGCACAACCTGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020625.3-1300s21c1
Sequence:CCGGGTGAATCCTCCAATGACTTTGCTCGAGCAAAGTCATTGGAGGATTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_020625.2-1063s1c1
Sequence:CCGGCCCGATCTAGAAGATGAGGAACTCGAGTTCCTCATCTTCTAGATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020625.2-1608s1c1
Sequence:CCGGGCACGTGAATATGCATCTCAACTCGAGTTGAGATGCATATTCACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_020625.2-1177s1c1
Sequence:CCGGACCCTCAGTATCAGTGATGTTCTCGAGAACATCACTGATACTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020625.2-991s1c1
Sequence:CCGGCCACAGAAACACTGGGTGTATCTCGAGATACACCCAGTGTTTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020625.2-2082s1c1
Sequence:CCGGCCACCAAACAGTCTTCCCTTACTCGAGTAAGGGAAGACTGTTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks