EMAIL THIS PAGE TO A FRIEND

ZBTB24

zinc finger and BTB domain containing 24

Synonyms: BIF1 ICF2 PATZ2 ZNF450
UniProtKB ID: O43167, Q17RC6, Q5TED5, Q8N455
Gene ID:
Human(9841) Summary: This gene encodes a protein similar to a protein in rodents which is induced by bone morphogenic protein 2 in vitro. [provided by RefSeq, Aug 2011]
Mouse(268294) zinc finger and BTB domain containing 24
Rat(365590) zinc finger and BTB domain containing 24
Zebrafish(553955) zinc finger and BTB domain containing 24
Horse(100066674) zinc finger and BTB domain containing 24
domestic cat(101101136) zinc finger and BTB domain containing 24
dog(475021) zinc finger and BTB domain containing 24
chicken(421763) zinc finger and BTB domain containing 24
domestic guinea pig(100715579) zinc finger and BTB domain containing 24
naked mole-rat(101703504) zinc finger and BTB domain containing 24
Domestic Rabbit(100348906) zinc finger and BTB domain containing 24
cow(539966) zinc finger and BTB domain containing 24
sheep(101113501) zinc finger and BTB domain containing 24
69 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153398 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153398 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153398 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014797 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014797 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014797 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU031801 MISSION® esiRNA esiRNA targeting mouse Zbtb24 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014797 Rosetta Predictions human pricing
NM_001098667 Rosetta Predictions rat pricing
NM_153398 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014797 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023844 predicted 1728
2 SASI_Hs01_00023845 predicted 938
3 SASI_Hs01_00023846 predicted 2096
4 SASI_Hs01_00023847 predicted 534
5 SASI_Hs01_00023848 predicted 1543
6 SASI_Hs02_00346302 predicted 1761
7 SASI_Hs01_00023849 predicted 1557
8 SASI_Hs01_00023850 predicted 342
9 SASI_Hs01_00023851 predicted 2278
10 SASI_Hs01_00023852 predicted 1350
11 SASI_Hs01_00023843 predicted 322
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098667 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00209131 predicted 1666
2 SASI_Rn02_00209132 predicted 2291
3 SASI_Rn02_00209133 predicted 2366
4 SASI_Rn02_00209134 predicted 453
5 SASI_Rn02_00209135 predicted 1824
6 SASI_Rn02_00209136 predicted 955
7 SASI_Rn02_00209137 predicted 798
8 SASI_Rn02_00209138 predicted 317
9 SASI_Rn02_00209139 predicted 1054
10 SASI_Rn02_00209140 predicted 208
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153398 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00195697 predicted 2376
2 SASI_Mm01_00195698 predicted 2275
3 SASI_Mm01_00195699 predicted 572
4 SASI_Mm01_00195700 predicted 2386
5 SASI_Mm01_00195701 predicted 722
6 SASI_Mm01_00195702 predicted 433
7 SASI_Mm01_00195703 predicted 372
8 SASI_Mm02_00343181 predicted 956
9 SASI_Mm01_00195704 predicted 1063
10 SASI_Mm01_00195705 predicted 1722
11 SASI_Mm01_00195706 predicted 1050
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153398
VALIDATED
ZBTB24 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 24
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153398.2-254s1c1
Sequence:CCGGCAAAGGAAGAAGGGCTTTCTTCTCGAGAAGAAAGCCCTTCTTCCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153398.2-2270s1c1
Sequence:CCGGCCATCATCTTACAGATCCTTACTCGAGTAAGGATCTGTAAGATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095539    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153398.2-2475s1c1
Sequence:CCGGCCATAGAGTATGGTCTTGTTTCTCGAGAAACAAGACCATACTCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153398.2-2060s1c1
Sequence:CCGGCCAGTGCATGTCATCACACTTCTCGAGAAGTGTGATGACATGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153398.2-1456s1c1
Sequence:CCGGGAAGCCATTTACTTGTGAAATCTCGAGATTTCACAAGTAAATGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153398
VALIDATED
ZBTB24 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 24
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153398.2-254s1c1
Sequence:CCGGCAAAGGAAGAAGGGCTTTCTTCTCGAGAAGAAAGCCCTTCTTCCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153398.2-2270s1c1
Sequence:CCGGCCATCATCTTACAGATCCTTACTCGAGTAAGGATCTGTAAGATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095539    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153398.2-2475s1c1
Sequence:CCGGCCATAGAGTATGGTCTTGTTTCTCGAGAAACAAGACCATACTCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153398.2-2060s1c1
Sequence:CCGGCCAGTGCATGTCATCACACTTCTCGAGAAGTGTGATGACATGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153398.2-1456s1c1
Sequence:CCGGGAAGCCATTTACTTGTGAAATCTCGAGATTTCACAAGTAAATGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153398
VALIDATED
ZBTB24 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 24
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153398.2-254s1c1
Sequence:CCGGCAAAGGAAGAAGGGCTTTCTTCTCGAGAAGAAAGCCCTTCTTCCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153398.2-2270s1c1
Sequence:CCGGCCATCATCTTACAGATCCTTACTCGAGTAAGGATCTGTAAGATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095539    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153398.2-2475s1c1
Sequence:CCGGCCATAGAGTATGGTCTTGTTTCTCGAGAAACAAGACCATACTCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153398.2-2060s1c1
Sequence:CCGGCCAGTGCATGTCATCACACTTCTCGAGAAGTGTGATGACATGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153398.2-1456s1c1
Sequence:CCGGGAAGCCATTTACTTGTGAAATCTCGAGATTTCACAAGTAAATGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014797
ZBTB24 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 24
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107435    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014797.1-5200s1c1
Sequence:CCGGGCAGTGTTTCACAATTCATTTCTCGAGAAATGAATTGTGAAACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014797.1-1645s1c1
Sequence:CCGGCCTGAGTGTAACTTACAGTTTCTCGAGAAACTGTAAGTTACACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014797.1-1733s1c1
Sequence:CCGGGCAGCATTTCTGGCAGTAGTACTCGAGTACTACTGCCAGAAATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014797.1-273s1c1
Sequence:CCGGCCTCTGTGACATTACTTTAATCTCGAGATTAAAGTAATGTCACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014797.1-338s1c1
Sequence:CCGGCCAGTAGTGAATACTTCTCAACTCGAGTTGAGAAGTATTCACTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014797
ZBTB24 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 24
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107435    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014797.1-5200s1c1
Sequence:CCGGGCAGTGTTTCACAATTCATTTCTCGAGAAATGAATTGTGAAACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014797.1-1645s1c1
Sequence:CCGGCCTGAGTGTAACTTACAGTTTCTCGAGAAACTGTAAGTTACACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014797.1-1733s1c1
Sequence:CCGGGCAGCATTTCTGGCAGTAGTACTCGAGTACTACTGCCAGAAATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014797.1-273s1c1
Sequence:CCGGCCTCTGTGACATTACTTTAATCTCGAGATTAAAGTAATGTCACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014797.1-338s1c1
Sequence:CCGGCCAGTAGTGAATACTTCTCAACTCGAGTTGAGAAGTATTCACTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014797
ZBTB24 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 24
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107435    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014797.1-5200s1c1
Sequence:CCGGGCAGTGTTTCACAATTCATTTCTCGAGAAATGAATTGTGAAACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014797.1-1645s1c1
Sequence:CCGGCCTGAGTGTAACTTACAGTTTCTCGAGAAACTGTAAGTTACACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014797.1-1733s1c1
Sequence:CCGGGCAGCATTTCTGGCAGTAGTACTCGAGTACTACTGCCAGAAATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014797.1-273s1c1
Sequence:CCGGCCTCTGTGACATTACTTTAATCTCGAGATTAAAGTAATGTCACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014797.1-338s1c1
Sequence:CCGGCCAGTAGTGAATACTTCTCAACTCGAGTTGAGAAGTATTCACTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks