EMAIL THIS PAGE TO A FRIEND

ZBTB25

zinc finger and BTB domain containing 25

Synonyms: C14orf51 KUP ZNF46
UniProtKB ID: P24278, B3KUX6, Q8IYH9
Gene ID:
Mouse(109929) zinc finger and BTB domain containing 25
Rat(314245) zinc finger and BTB domain containing 25
cow(538889) zinc finger and BTB domain containing 25
sheep(101109541) zinc finger and BTB domain containing 25
naked mole-rat(101706681) zinc finger and BTB domain containing 25
domestic guinea pig(100712842) zinc finger and BTB domain containing 25
Zebrafish(567401) zinc finger and BTB domain containing 25
chicken(423505) zinc finger and BTB domain containing 25
dog(490730) zinc finger and BTB domain containing 25
domestic cat(101087325) zinc finger and BTB domain containing 25
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006977 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006977 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006977 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028356 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028356 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028356 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006977 Rosetta Predictions human pricing
NM_199496 Rosetta Predictions rat pricing
NM_028356 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006977 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143040 predicted 1130
2 SASI_Hs01_00143041 predicted 442
3 SASI_Hs01_00143042 predicted 781
4 SASI_Hs01_00143043 predicted 488
5 SASI_Hs02_00342708 predicted 1077
6 SASI_Hs01_00143044 predicted 379
7 SASI_Hs01_00143046 predicted 1145
8 SASI_Hs01_00143047 predicted 219
9 SASI_Hs01_00143048 predicted 1348
10 SASI_Hs01_00143049 predicted 1299
11 SASI_Hs01_00143045 predicted 337
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199496 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090011 predicted 1134
2 SASI_Rn01_00090012 predicted 888
3 SASI_Rn01_00090013 predicted 235
4 SASI_Rn02_00270267 predicted 1139
5 SASI_Rn01_00090014 predicted 659
6 SASI_Rn01_00090015 predicted 1111
7 SASI_Rn01_00090016 predicted 303
8 SASI_Rn01_00090017 predicted 1445
9 SASI_Rn01_00090018 predicted 744
10 SASI_Rn02_00270268 predicted 1107
11 SASI_Rn01_00090019 predicted 1306
12 SASI_Rn01_00090020 predicted 1177
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028356 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00072810 predicted 1202
2 SASI_Mm01_00072811 predicted 1220
3 SASI_Mm01_00072812 predicted 471
4 SASI_Mm01_00072813 predicted 1198
5 SASI_Mm01_00072814 predicted 1174
6 SASI_Mm02_00333731 predicted 1096
7 SASI_Mm02_00333732 predicted 1282
8 SASI_Mm01_00072816 predicted 798
9 SASI_Mm01_00072817 predicted 474
10 SASI_Mm01_00072819 predicted 1225
11 SASI_Mm01_00072815 predicted 727
12 SASI_Mm01_00072818 predicted 1242
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006977
VALIDATED
ZBTB25 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 25
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006977.2-387s1c1
Sequence:CCGGCCAACCTGACATATTCAGCTACTCGAGTAGCTGAATATGTCAGGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006977.2-994s1c1
Sequence:CCGGGCTTCCATTCTGGAAAGTAATCTCGAGATTACTTTCCAGAATGGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006977.2-1182s1c1
Sequence:CCGGGCCAGTAGAATTAAACTGTAACTCGAGTTACAGTTTAATTCTACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006977.2-493s1c1
Sequence:CCGGGCCGACTACCTTTCTCACATTCTCGAGAATGTGAGAAAGGTAGTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006977.2-1405s1c1
Sequence:CCGGCGCTTGTCACAAGAACACTTACTCGAGTAAGTGTTCTTGTGACAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006977.2-387s21c1
Sequence:CCGGCCAACCTGACATATTCAGCTACTCGAGTAGCTGAATATGTCAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006977.2-466s21c1
Sequence:CCGGTTGGAGGAAGGGATTCGATTTCTCGAGAAATCGAATCCCTTCCTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006977.2-994s21c1
Sequence:CCGGGCTTCCATTCTGGAAAGTAATCTCGAGATTACTTTCCAGAATGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006977.2-1144s21c1
Sequence:CCGGCAGATCAGTCAAGTATCTTTGCTCGAGCAAAGATACTTGACTGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006977.2-493s21c1
Sequence:CCGGGCCGACTACCTTTCTCACATTCTCGAGAATGTGAGAAAGGTAGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006977
VALIDATED
ZBTB25 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 25
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006977.2-387s1c1
Sequence:CCGGCCAACCTGACATATTCAGCTACTCGAGTAGCTGAATATGTCAGGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006977.2-994s1c1
Sequence:CCGGGCTTCCATTCTGGAAAGTAATCTCGAGATTACTTTCCAGAATGGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006977.2-1182s1c1
Sequence:CCGGGCCAGTAGAATTAAACTGTAACTCGAGTTACAGTTTAATTCTACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006977.2-493s1c1
Sequence:CCGGGCCGACTACCTTTCTCACATTCTCGAGAATGTGAGAAAGGTAGTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006977.2-1405s1c1
Sequence:CCGGCGCTTGTCACAAGAACACTTACTCGAGTAAGTGTTCTTGTGACAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006977.2-387s21c1
Sequence:CCGGCCAACCTGACATATTCAGCTACTCGAGTAGCTGAATATGTCAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006977.2-466s21c1
Sequence:CCGGTTGGAGGAAGGGATTCGATTTCTCGAGAAATCGAATCCCTTCCTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006977.2-994s21c1
Sequence:CCGGGCTTCCATTCTGGAAAGTAATCTCGAGATTACTTTCCAGAATGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006977.2-1144s21c1
Sequence:CCGGCAGATCAGTCAAGTATCTTTGCTCGAGCAAAGATACTTGACTGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006977.2-493s21c1
Sequence:CCGGGCCGACTACCTTTCTCACATTCTCGAGAATGTGAGAAAGGTAGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006977
VALIDATED
ZBTB25 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 25
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006977.2-387s1c1
Sequence:CCGGCCAACCTGACATATTCAGCTACTCGAGTAGCTGAATATGTCAGGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006977.2-994s1c1
Sequence:CCGGGCTTCCATTCTGGAAAGTAATCTCGAGATTACTTTCCAGAATGGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006977.2-1182s1c1
Sequence:CCGGGCCAGTAGAATTAAACTGTAACTCGAGTTACAGTTTAATTCTACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006977.2-493s1c1
Sequence:CCGGGCCGACTACCTTTCTCACATTCTCGAGAATGTGAGAAAGGTAGTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006977.2-1405s1c1
Sequence:CCGGCGCTTGTCACAAGAACACTTACTCGAGTAAGTGTTCTTGTGACAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006977.2-387s21c1
Sequence:CCGGCCAACCTGACATATTCAGCTACTCGAGTAGCTGAATATGTCAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006977.2-466s21c1
Sequence:CCGGTTGGAGGAAGGGATTCGATTTCTCGAGAAATCGAATCCCTTCCTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006977.2-994s21c1
Sequence:CCGGGCTTCCATTCTGGAAAGTAATCTCGAGATTACTTTCCAGAATGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006977.2-1144s21c1
Sequence:CCGGCAGATCAGTCAAGTATCTTTGCTCGAGCAAAGATACTTGACTGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006977.2-493s21c1
Sequence:CCGGGCCGACTACCTTTCTCACATTCTCGAGAATGTGAGAAAGGTAGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028356
ZBTB25 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 25
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193305    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028356.1-1072s1c1
Sequence:CCGGCTTTGCAGATTAGTCAAGTATCTCGAGATACTTGACTAATCTGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175181    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028356.1-812s1c1
Sequence:CCGGCAAAGTCCACTTATGCCATTACTCGAGTAATGGCATAAGTGGACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174537    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028356.1-1229s1c1
Sequence:CCGGCAAAGGTAAATCCTACAGATACTCGAGTATCTGTAGGATTTACCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028356.1-478s21c1
Sequence:CCGGCATCTAATTTGTATGGTATTCCTCGAGGAATACCATACAAATTAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028356.1-1232s21c1
Sequence:CCGGAGGTAAATCCTACAGATATAACTCGAGTTATATCTGTAGGATTTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028356.1-1077s21c1
Sequence:CCGGCAGATTAGTCAAGTATCTTTGCTCGAGCAAAGATACTTGACTAATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028356.1-806s21c1
Sequence:CCGGCAGTATCAAAGTCCACTTATGCTCGAGCATAAGTGGACTTTGATACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241490    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028356.1-1448s21c1
Sequence:CCGGTACTGATCTTGGAGGAGATTTCTCGAGAAATCTCCTCCAAGATCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028356
ZBTB25 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 25
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193305    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028356.1-1072s1c1
Sequence:CCGGCTTTGCAGATTAGTCAAGTATCTCGAGATACTTGACTAATCTGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175181    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028356.1-812s1c1
Sequence:CCGGCAAAGTCCACTTATGCCATTACTCGAGTAATGGCATAAGTGGACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174537    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028356.1-1229s1c1
Sequence:CCGGCAAAGGTAAATCCTACAGATACTCGAGTATCTGTAGGATTTACCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028356.1-478s21c1
Sequence:CCGGCATCTAATTTGTATGGTATTCCTCGAGGAATACCATACAAATTAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028356.1-1232s21c1
Sequence:CCGGAGGTAAATCCTACAGATATAACTCGAGTTATATCTGTAGGATTTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028356.1-1077s21c1
Sequence:CCGGCAGATTAGTCAAGTATCTTTGCTCGAGCAAAGATACTTGACTAATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028356.1-806s21c1
Sequence:CCGGCAGTATCAAAGTCCACTTATGCTCGAGCATAAGTGGACTTTGATACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241490    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028356.1-1448s21c1
Sequence:CCGGTACTGATCTTGGAGGAGATTTCTCGAGAAATCTCCTCCAAGATCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028356
ZBTB25 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 25
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193305    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028356.1-1072s1c1
Sequence:CCGGCTTTGCAGATTAGTCAAGTATCTCGAGATACTTGACTAATCTGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175181    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028356.1-812s1c1
Sequence:CCGGCAAAGTCCACTTATGCCATTACTCGAGTAATGGCATAAGTGGACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174537    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028356.1-1229s1c1
Sequence:CCGGCAAAGGTAAATCCTACAGATACTCGAGTATCTGTAGGATTTACCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028356.1-478s21c1
Sequence:CCGGCATCTAATTTGTATGGTATTCCTCGAGGAATACCATACAAATTAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028356.1-1232s21c1
Sequence:CCGGAGGTAAATCCTACAGATATAACTCGAGTTATATCTGTAGGATTTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028356.1-1077s21c1
Sequence:CCGGCAGATTAGTCAAGTATCTTTGCTCGAGCAAAGATACTTGACTAATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028356.1-806s21c1
Sequence:CCGGCAGTATCAAAGTCCACTTATGCTCGAGCATAAGTGGACTTTGATACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241490    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028356.1-1448s21c1
Sequence:CCGGTACTGATCTTGGAGGAGATTTCTCGAGAAATCTCCTCCAAGATCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks