EMAIL THIS PAGE TO A FRIEND

ZBTB26

zinc finger and BTB domain containing 26

Synonyms: ZNF481 bioref
UniProtKB ID: Q9HCK0, B3KQ53, Q8WTR1
Gene ID:
Mouse(320633) zinc finger and BTB domain containing 26
Rat(311910) zinc finger and BTB domain containing 26
chicken(417107) zinc finger and BTB domain containing 26
Horse(100067432) zinc finger and BTB domain containing 26
domestic cat(101101175) zinc finger and BTB domain containing 26
dog(491342) zinc finger and BTB domain containing 26
domestic guinea pig(100731017) zinc finger and BTB domain containing 26
naked mole-rat(101725270) zinc finger and BTB domain containing 26
cow(100848248) zinc finger and BTB domain containing 26
sheep(101110216) zinc finger and BTB domain containing 26
176 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020924 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020924 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020924 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_199025 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_199025 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_199025 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU031201 MISSION® esiRNA esiRNA human ZBTB26 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020924 Rosetta Predictions human pricing
NM_001107840 Rosetta Predictions rat pricing
NM_199025 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020924 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354306 predicted 845
2 SASI_Hs01_00078891 predicted 324
3 SASI_Hs02_00354307 predicted 585
4 SASI_Hs01_00078892 predicted 1204
5 SASI_Hs01_00078893 predicted 1432
6 SASI_Hs02_00354308 predicted 926
7 SASI_Hs01_00078895 predicted 1368
8 SASI_Hs01_00078896 predicted 405
9 SASI_Hs02_00354309 predicted 614
10 SASI_Hs01_00078897 predicted 1132
11 SASI_Hs01_00078890 predicted 289
12 SASI_Hs01_00078894 predicted 241
13 SASI_Hs01_00078898 predicted 1299
14 SASI_Hs01_00078899 predicted 1444
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107840 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232795 predicted 389
2 SASI_Rn02_00232796 predicted 660
3 SASI_Rn02_00232797 predicted 994
4 SASI_Rn02_00232798 predicted 481
5 SASI_Rn02_00232799 predicted 816
6 SASI_Rn02_00232800 predicted 1430
7 SASI_Rn02_00232801 predicted 954
8 SASI_Rn02_00232802 predicted 734
9 SASI_Rn02_00232803 predicted 680
10 SASI_Rn02_00232804 predicted 1257
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199025 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058675 predicted 1324
2 SASI_Mm01_00058676 predicted 481
3 SASI_Mm01_00058677 predicted 1748
4 SASI_Mm01_00058678 predicted 958
5 SASI_Mm01_00058679 predicted 1301
6 SASI_Mm01_00058680 predicted 775
7 SASI_Mm01_00058681 predicted 1124
8 SASI_Mm01_00058682 predicted 454
9 SASI_Mm01_00058683 predicted 1732
10 SASI_Mm01_00058684 predicted 1038
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020924
VALIDATED
ZBTB26 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 26
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020924.2-1024s21c1
Sequence:CCGGTGCGTGTGCATGCCGGAATTACTCGAGTAATTCCGGCATGCACACGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229963    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020924.2-1741s21c1
Sequence:CCGGATCACCTACTCTCCACTAATACTCGAGTATTAGTGGAGAGTAGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020924.2-839s21c1
Sequence:GTACCGGAGATGTCTTTGGCCCTAATATCTCGAGATATTAGGGCCAAAGACATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020924.2-932s21c1
Sequence:GTACCGGGAACTACGCCAACCATTTAAACTCGAGTTTAAATGGTTGGCGTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020924.2-321s21c1
Sequence:CCGGCAATTGCTCTTATCCTGTTATCTCGAGATAACAGGATAAGAGCAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107410    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020924.2-1658s1c1
Sequence:CCGGCCTAACATTGACTTATGTCTTCTCGAGAAGACATAAGTCAATGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020924.2-240s1c1
Sequence:CCGGCCCTTCTTAAGAGACCAATTTCTCGAGAAATTGGTCTCTTAAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020924.2-1354s1c1
Sequence:CCGGCCCAAGCTGTCCTGAACTTAACTCGAGTTAAGTTCAGGACAGCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020924.2-785s1c1
Sequence:CCGGCCACAATTATGCCCTTTCTTACTCGAGTAAGAAAGGGCATAATTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020924.2-900s1c1
Sequence:CCGGCCAAAGTGTACCAGGGTGTTTCTCGAGAAACACCCTGGTACACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020924
VALIDATED
ZBTB26 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 26
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020924.2-1024s21c1
Sequence:CCGGTGCGTGTGCATGCCGGAATTACTCGAGTAATTCCGGCATGCACACGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229963    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020924.2-1741s21c1
Sequence:CCGGATCACCTACTCTCCACTAATACTCGAGTATTAGTGGAGAGTAGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020924.2-839s21c1
Sequence:GTACCGGAGATGTCTTTGGCCCTAATATCTCGAGATATTAGGGCCAAAGACATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020924.2-932s21c1
Sequence:GTACCGGGAACTACGCCAACCATTTAAACTCGAGTTTAAATGGTTGGCGTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020924.2-321s21c1
Sequence:CCGGCAATTGCTCTTATCCTGTTATCTCGAGATAACAGGATAAGAGCAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107410    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020924.2-1658s1c1
Sequence:CCGGCCTAACATTGACTTATGTCTTCTCGAGAAGACATAAGTCAATGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020924.2-240s1c1
Sequence:CCGGCCCTTCTTAAGAGACCAATTTCTCGAGAAATTGGTCTCTTAAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020924.2-1354s1c1
Sequence:CCGGCCCAAGCTGTCCTGAACTTAACTCGAGTTAAGTTCAGGACAGCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020924.2-785s1c1
Sequence:CCGGCCACAATTATGCCCTTTCTTACTCGAGTAAGAAAGGGCATAATTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020924.2-900s1c1
Sequence:CCGGCCAAAGTGTACCAGGGTGTTTCTCGAGAAACACCCTGGTACACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020924
VALIDATED
ZBTB26 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 26
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020924.2-1024s21c1
Sequence:CCGGTGCGTGTGCATGCCGGAATTACTCGAGTAATTCCGGCATGCACACGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229963    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020924.2-1741s21c1
Sequence:CCGGATCACCTACTCTCCACTAATACTCGAGTATTAGTGGAGAGTAGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020924.2-839s21c1
Sequence:GTACCGGAGATGTCTTTGGCCCTAATATCTCGAGATATTAGGGCCAAAGACATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020924.2-932s21c1
Sequence:GTACCGGGAACTACGCCAACCATTTAAACTCGAGTTTAAATGGTTGGCGTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020924.2-321s21c1
Sequence:CCGGCAATTGCTCTTATCCTGTTATCTCGAGATAACAGGATAAGAGCAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107410    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020924.2-1658s1c1
Sequence:CCGGCCTAACATTGACTTATGTCTTCTCGAGAAGACATAAGTCAATGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020924.2-240s1c1
Sequence:CCGGCCCTTCTTAAGAGACCAATTTCTCGAGAAATTGGTCTCTTAAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020924.2-1354s1c1
Sequence:CCGGCCCAAGCTGTCCTGAACTTAACTCGAGTTAAGTTCAGGACAGCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020924.2-785s1c1
Sequence:CCGGCCACAATTATGCCCTTTCTTACTCGAGTAAGAAAGGGCATAATTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020924.2-900s1c1
Sequence:CCGGCCAAAGTGTACCAGGGTGTTTCTCGAGAAACACCCTGGTACACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199025
VALIDATED
ZBTB26 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 26
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095519    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199025.2-2405s1c1
Sequence:CCGGGCGGATAATCAGTAAATGATACTCGAGTATCATTTACTGATTATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199025.2-1232s1c1
Sequence:CCGGCGAGGTGTAGACAAAGGCTTACTCGAGTAAGCCTTTGTCTACACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199025.2-611s1c1
Sequence:CCGGCCCTTCTTAAGAGACCAGTTTCTCGAGAAACTGGTCTCTTAAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199025.2-935s1c1
Sequence:CCGGCCTTGTATTCATCCATCTGAACTCGAGTTCAGATGGATGAATACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199025.2-1270s1c1
Sequence:CCGGCCCAAAGTGTACCAGGGTATTCTCGAGAATACCCTGGTACACTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199025
VALIDATED
ZBTB26 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 26
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095519    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199025.2-2405s1c1
Sequence:CCGGGCGGATAATCAGTAAATGATACTCGAGTATCATTTACTGATTATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199025.2-1232s1c1
Sequence:CCGGCGAGGTGTAGACAAAGGCTTACTCGAGTAAGCCTTTGTCTACACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199025.2-611s1c1
Sequence:CCGGCCCTTCTTAAGAGACCAGTTTCTCGAGAAACTGGTCTCTTAAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199025.2-935s1c1
Sequence:CCGGCCTTGTATTCATCCATCTGAACTCGAGTTCAGATGGATGAATACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199025.2-1270s1c1
Sequence:CCGGCCCAAAGTGTACCAGGGTATTCTCGAGAATACCCTGGTACACTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199025
VALIDATED
ZBTB26 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 26
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095519    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199025.2-2405s1c1
Sequence:CCGGGCGGATAATCAGTAAATGATACTCGAGTATCATTTACTGATTATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199025.2-1232s1c1
Sequence:CCGGCGAGGTGTAGACAAAGGCTTACTCGAGTAAGCCTTTGTCTACACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199025.2-611s1c1
Sequence:CCGGCCCTTCTTAAGAGACCAGTTTCTCGAGAAACTGGTCTCTTAAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199025.2-935s1c1
Sequence:CCGGCCTTGTATTCATCCATCTGAACTCGAGTTCAGATGGATGAATACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199025.2-1270s1c1
Sequence:CCGGCCCAAAGTGTACCAGGGTATTCTCGAGAATACCCTGGTACACTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks