EMAIL THIS PAGE TO A FRIEND

ZBTB2

zinc finger and BTB domain containing 2

Synonyms: ZNF437
UniProtKB ID: Q8N680, A8K7C7, Q5SZ81, Q9P245
Gene ID:
Mouse(381990) zinc finger and BTB domain containing 2
Rat(308126) zinc finger and BTB domain containing 2
chicken(421635) zinc finger and BTB domain containing 2
dog(484036) zinc finger and BTB domain containing 2
domestic cat(101100642) zinc finger and BTB domain containing 2
Horse(100060294) zinc finger and BTB domain containing 2
domestic guinea pig(100724645) zinc finger and BTB domain containing 2
naked mole-rat(101718837) zinc finger and BTB domain containing 2
Domestic Rabbit(100347498) zinc finger and BTB domain containing 2
cow(513775) zinc finger and BTB domain containing 2
sheep(101102493) zinc finger and BTB domain containing 2
105 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020861 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020861 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020861 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033466 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033466 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033466 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020861 Rosetta Predictions human pricing
NM_001107460 Rosetta Predictions rat pricing
NM_001033466 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020861 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202386 predicted 1445
2 SASI_Hs01_00202387 predicted 1665
3 SASI_Hs01_00202388 predicted 1379
4 SASI_Hs01_00202389 predicted 1628
5 SASI_Hs01_00202390 predicted 1751
6 SASI_Hs01_00202391 predicted 328
7 SASI_Hs01_00202392 predicted 1213
8 SASI_Hs01_00202393 predicted 226
9 SASI_Hs01_00202394 predicted 829
10 SASI_Hs01_00202395 predicted 1393
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107460 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229045 predicted 714
2 SASI_Rn02_00229046 predicted 1977
3 SASI_Rn02_00229047 predicted 236
4 SASI_Rn02_00229048 predicted 211
5 SASI_Rn02_00229049 predicted 1847
6 SASI_Rn02_00229050 predicted 1849
7 SASI_Rn02_00229051 predicted 1287
8 SASI_Rn02_00229052 predicted 1919
9 SASI_Rn02_00229053 predicted 1088
10 SASI_Rn02_00229054 predicted 1843
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033466 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092961 predicted 1808
2 SASI_Mm01_00092962 predicted 834
3 SASI_Mm01_00092963 predicted 1797
4 SASI_Mm01_00092964 predicted 406
5 SASI_Mm01_00092965 predicted 1653
6 SASI_Mm01_00092966 predicted 496
7 SASI_Mm01_00092967 predicted 1348
8 SASI_Mm02_00288817 predicted 1764
9 SASI_Mm01_00092968 predicted 388
10 SASI_Mm02_00288818 predicted 1335
11 SASI_Mm01_00092969 predicted 408
12 SASI_Mm01_00092970 predicted 1190
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020861
VALIDATED
ZBTB2 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 2
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020861.1-689s1c1
Sequence:CCGGCCCAGGTGAATCGGACAAATACTCGAGTATTTGTCCGATTCACCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020861.1-1229s1c1
Sequence:CCGGGCACAATATGTGGACGCAAATCTCGAGATTTGCGTCCACATATTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020861.1-547s1c1
Sequence:CCGGGCAGATCATCAGTTGAGACAACTCGAGTTGTCTCAACTGATGATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020861.1-1629s1c1
Sequence:CCGGCCCAGTGTTAGCTTCCATCAACTCGAGTTGATGGAAGCTAACACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020861.1-1153s1c1
Sequence:CCGGCCCTCAGACATTGCTGACATTCTCGAGAATGTCAGCAATGTCTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020861.1-308s21c1
Sequence:CCGGGTGAGTGTGTCCGCTTGAAACCTCGAGGTTTCAAGCGGACACACTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020861.1-878s21c1
Sequence:CCGGGGAGCTTTCCAAAGTACTATGCTCGAGCATAGTACTTTGGAAAGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020861.1-1652s21c1
Sequence:CCGGAGGAACAAGAAACCGTCTTACCTCGAGGTAAGACGGTTTCTTGTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415675    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020861.1-1855s21c1
Sequence:CCGGACCTGGAATGTATCGACTTTCCTCGAGGAAAGTCGATACATTCCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020861.1-176s21c1
Sequence:CCGGTAAACGCTCAGCGAGAGTTTGCTCGAGCAAACTCTCGCTGAGCGTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020861.1-263s21c1
Sequence:CCGGCTTCATTCTCCAATTACTTTACTCGAGTAAAGTAATTGGAGAATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020861.1-738s21c1
Sequence:CCGGGCTGTCTCCAGAACTTGTTTCCTCGAGGAAACAAGTTCTGGAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020861.1-216s21c1
Sequence:CCGGGGTTGCAATCGGCGATGTATACTCGAGTATACATCGCCGATTGCAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020861
VALIDATED
ZBTB2 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 2
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020861.1-689s1c1
Sequence:CCGGCCCAGGTGAATCGGACAAATACTCGAGTATTTGTCCGATTCACCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020861.1-1229s1c1
Sequence:CCGGGCACAATATGTGGACGCAAATCTCGAGATTTGCGTCCACATATTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020861.1-547s1c1
Sequence:CCGGGCAGATCATCAGTTGAGACAACTCGAGTTGTCTCAACTGATGATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020861.1-1629s1c1
Sequence:CCGGCCCAGTGTTAGCTTCCATCAACTCGAGTTGATGGAAGCTAACACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020861.1-1153s1c1
Sequence:CCGGCCCTCAGACATTGCTGACATTCTCGAGAATGTCAGCAATGTCTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020861.1-308s21c1
Sequence:CCGGGTGAGTGTGTCCGCTTGAAACCTCGAGGTTTCAAGCGGACACACTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020861.1-878s21c1
Sequence:CCGGGGAGCTTTCCAAAGTACTATGCTCGAGCATAGTACTTTGGAAAGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020861.1-1652s21c1
Sequence:CCGGAGGAACAAGAAACCGTCTTACCTCGAGGTAAGACGGTTTCTTGTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415675    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020861.1-1855s21c1
Sequence:CCGGACCTGGAATGTATCGACTTTCCTCGAGGAAAGTCGATACATTCCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020861.1-176s21c1
Sequence:CCGGTAAACGCTCAGCGAGAGTTTGCTCGAGCAAACTCTCGCTGAGCGTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020861.1-263s21c1
Sequence:CCGGCTTCATTCTCCAATTACTTTACTCGAGTAAAGTAATTGGAGAATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020861.1-738s21c1
Sequence:CCGGGCTGTCTCCAGAACTTGTTTCCTCGAGGAAACAAGTTCTGGAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020861.1-216s21c1
Sequence:CCGGGGTTGCAATCGGCGATGTATACTCGAGTATACATCGCCGATTGCAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020861
VALIDATED
ZBTB2 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 2
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020861.1-689s1c1
Sequence:CCGGCCCAGGTGAATCGGACAAATACTCGAGTATTTGTCCGATTCACCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020861.1-1229s1c1
Sequence:CCGGGCACAATATGTGGACGCAAATCTCGAGATTTGCGTCCACATATTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020861.1-547s1c1
Sequence:CCGGGCAGATCATCAGTTGAGACAACTCGAGTTGTCTCAACTGATGATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020861.1-1629s1c1
Sequence:CCGGCCCAGTGTTAGCTTCCATCAACTCGAGTTGATGGAAGCTAACACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020861.1-1153s1c1
Sequence:CCGGCCCTCAGACATTGCTGACATTCTCGAGAATGTCAGCAATGTCTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020861.1-308s21c1
Sequence:CCGGGTGAGTGTGTCCGCTTGAAACCTCGAGGTTTCAAGCGGACACACTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020861.1-878s21c1
Sequence:CCGGGGAGCTTTCCAAAGTACTATGCTCGAGCATAGTACTTTGGAAAGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020861.1-1652s21c1
Sequence:CCGGAGGAACAAGAAACCGTCTTACCTCGAGGTAAGACGGTTTCTTGTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415675    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020861.1-1855s21c1
Sequence:CCGGACCTGGAATGTATCGACTTTCCTCGAGGAAAGTCGATACATTCCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020861.1-176s21c1
Sequence:CCGGTAAACGCTCAGCGAGAGTTTGCTCGAGCAAACTCTCGCTGAGCGTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020861.1-263s21c1
Sequence:CCGGCTTCATTCTCCAATTACTTTACTCGAGTAAAGTAATTGGAGAATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020861.1-738s21c1
Sequence:CCGGGCTGTCTCCAGAACTTGTTTCCTCGAGGAAACAAGTTCTGGAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020861.1-216s21c1
Sequence:CCGGGGTTGCAATCGGCGATGTATACTCGAGTATACATCGCCGATTGCAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033466
ZBTB2 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000226173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033466.2-829s21c1
Sequence:CCGGGCCCAGGTGAATCGGACAAATCTCGAGATTTGTCCGATTCACCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033466.2-557s21c1
Sequence:CCGGGGCTAGAGCAAGGGATCAAATCTCGAGATTTGATCCCTTGCTCTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033466.2-317s21c1
Sequence:CCGGTAAACGCTCAGCGAGAGTTTGCTCGAGCAAACTCTCGCTGAGCGTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033466.3-1804s21c1
Sequence:CCGGACTGTGTTACTAGACTGAATGCTCGAGCATTCAGTCTAGTAACACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033466.3-1771s21c1
Sequence:CCGGCCTGTGTTAGCGTCCATCAAACTCGAGTTTGATGGACGCTAACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033466.2-706s21c1
Sequence:GTACCGGCAAGCCACCAAGATGAATTTACTCGAGTAAATTCATCTTGGTGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257299    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033466.2-2011s21c1
Sequence:CCGGATAATGGTCAGTAGTACTTATCTCGAGATAAGTACTACTGACCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033466
ZBTB2 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000226173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033466.2-829s21c1
Sequence:CCGGGCCCAGGTGAATCGGACAAATCTCGAGATTTGTCCGATTCACCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033466.2-557s21c1
Sequence:CCGGGGCTAGAGCAAGGGATCAAATCTCGAGATTTGATCCCTTGCTCTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033466.2-317s21c1
Sequence:CCGGTAAACGCTCAGCGAGAGTTTGCTCGAGCAAACTCTCGCTGAGCGTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033466.3-1804s21c1
Sequence:CCGGACTGTGTTACTAGACTGAATGCTCGAGCATTCAGTCTAGTAACACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033466.3-1771s21c1
Sequence:CCGGCCTGTGTTAGCGTCCATCAAACTCGAGTTTGATGGACGCTAACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033466.2-706s21c1
Sequence:GTACCGGCAAGCCACCAAGATGAATTTACTCGAGTAAATTCATCTTGGTGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257299    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033466.2-2011s21c1
Sequence:CCGGATAATGGTCAGTAGTACTTATCTCGAGATAAGTACTACTGACCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033466
ZBTB2 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000226173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033466.2-829s21c1
Sequence:CCGGGCCCAGGTGAATCGGACAAATCTCGAGATTTGTCCGATTCACCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033466.2-557s21c1
Sequence:CCGGGGCTAGAGCAAGGGATCAAATCTCGAGATTTGATCCCTTGCTCTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033466.2-317s21c1
Sequence:CCGGTAAACGCTCAGCGAGAGTTTGCTCGAGCAAACTCTCGCTGAGCGTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033466.3-1804s21c1
Sequence:CCGGACTGTGTTACTAGACTGAATGCTCGAGCATTCAGTCTAGTAACACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033466.3-1771s21c1
Sequence:CCGGCCTGTGTTAGCGTCCATCAAACTCGAGTTTGATGGACGCTAACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033466.2-706s21c1
Sequence:GTACCGGCAAGCCACCAAGATGAATTTACTCGAGTAAATTCATCTTGGTGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257299    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033466.2-2011s21c1
Sequence:CCGGATAATGGTCAGTAGTACTTATCTCGAGATAAGTACTACTGACCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks