EMAIL THIS PAGE TO A FRIEND

ZBTB32

zinc finger and BTB domain containing 32

Synonyms: FAXF FAZF Rog TZFP ZNF538
UniProtKB ID: Q9Y2Y4, Q8WVP2
Gene ID:
Mouse(58206) zinc finger and BTB domain containing 32
Rat(688845) zinc finger and BTB domain containing 32
domestic guinea pig(100734892) zinc finger and BTB domain containing 32
naked mole-rat(101699273) zinc finger and BTB domain containing 32
cow(785741) zinc finger and BTB domain containing 32
sheep(101106354) zinc finger and BTB domain containing 32
dog(484577) zinc finger and BTB domain containing 32
Horse(100059770) zinc finger and BTB domain containing 32
domestic cat(101099008) zinc finger and BTB domain containing 32
169 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021397 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021397 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021397 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014383 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014383 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014383 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014383 Rosetta Predictions human pricing
NM_001109517 Rosetta Predictions rat pricing
NM_021397 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014383 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199126 predicted 1686
2 SASI_Hs02_00345542 predicted 599
3 SASI_Hs01_00199127 predicted 655
4 SASI_Hs01_00199128 predicted 243
5 SASI_Hs01_00199129 predicted 285
6 SASI_Hs02_00345543 predicted 598
7 SASI_Hs01_00199130 predicted 1078
8 SASI_Hs01_00199131 predicted 1693
9 SASI_Hs01_00199132 predicted 1674
10 SASI_Hs01_00199134 predicted 1685
11 SASI_Hs01_00199133 predicted 416
12 SASI_Hs01_00199135 predicted 870
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109517 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00249179 predicted 828
2 SASI_Rn02_00249180 predicted 1178
3 SASI_Rn02_00249181 predicted 899
4 SASI_Rn02_00249182 predicted 651
5 SASI_Rn02_00249183 predicted 1506
6 SASI_Rn02_00249184 predicted 1170
7 SASI_Rn02_00249185 predicted 1012
8 SASI_Rn02_00249186 predicted 920
9 SASI_Rn02_00249187 predicted 1494
10 SASI_Rn02_00249188 predicted 1059
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021397 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109710 predicted 313
2 SASI_Mm01_00109711 predicted 610
3 SASI_Mm01_00109712 predicted 337
4 SASI_Mm01_00109713 predicted 341
5 SASI_Mm01_00109715 predicted 497
6 SASI_Mm02_00326002 predicted 205
7 SASI_Mm02_00326003 predicted 207
8 SASI_Mm01_00109716 predicted 403
9 SASI_Mm02_00326004 predicted 1550
10 SASI_Mm01_00109717 predicted 669
11 SASI_Mm01_00109714 predicted 1077
12 SASI_Mm01_00109718 predicted 966
13 SASI_Mm01_00109719 predicted 1082
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021397
VALIDATED
ZBTB32 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 32
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000444959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021397.2-1130s21c1
Sequence:CCGGATCTCACCAACACCCTCCTTTCTCGAGAAAGGAGGGTGTTGGTGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021397.2-169s21c1
Sequence:CCGGCTGATAGGTTGGTACAGTTAGCTCGAGCTAACTGTACCAACCTATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021397.2-855s21c1
Sequence:CCGGTTGTTGTGGCCCTCCAGATACCTCGAGGTATCTGGAGGGCCACAACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021397.2-691s21c1
Sequence:CCGGAGGTCATGCGAGGTATCGAGACTCGAGTCTCGATACCTCGCATGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096484    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021397.1-1459s1c1
Sequence:CCGGCTTGACAAAGAGTCCAAAGAACTCGAGTTCTTTGGACTCTTTGTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021397.1-962s1c1
Sequence:CCGGCAGATAGAAACGTCTGGGCAACTCGAGTTGCCCAGACGTTTCTATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021397.1-1123s1c1
Sequence:CCGGGCATCAGATGGAGACACATTACTCGAGTAATGTGTCTCCATCTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021397.1-421s1c1
Sequence:CCGGCCAGCAATCAGAAGACTTCATCTCGAGATGAAGTCTTCTGATTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021397.1-524s1c1
Sequence:CCGGGAGATGTCACACAAGCATAAACTCGAGTTTATGCTTGTGTGACATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021397
VALIDATED
ZBTB32 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 32
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000444959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021397.2-1130s21c1
Sequence:CCGGATCTCACCAACACCCTCCTTTCTCGAGAAAGGAGGGTGTTGGTGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021397.2-169s21c1
Sequence:CCGGCTGATAGGTTGGTACAGTTAGCTCGAGCTAACTGTACCAACCTATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021397.2-855s21c1
Sequence:CCGGTTGTTGTGGCCCTCCAGATACCTCGAGGTATCTGGAGGGCCACAACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021397.2-691s21c1
Sequence:CCGGAGGTCATGCGAGGTATCGAGACTCGAGTCTCGATACCTCGCATGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096484    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021397.1-1459s1c1
Sequence:CCGGCTTGACAAAGAGTCCAAAGAACTCGAGTTCTTTGGACTCTTTGTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021397.1-962s1c1
Sequence:CCGGCAGATAGAAACGTCTGGGCAACTCGAGTTGCCCAGACGTTTCTATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021397.1-1123s1c1
Sequence:CCGGGCATCAGATGGAGACACATTACTCGAGTAATGTGTCTCCATCTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021397.1-421s1c1
Sequence:CCGGCCAGCAATCAGAAGACTTCATCTCGAGATGAAGTCTTCTGATTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021397.1-524s1c1
Sequence:CCGGGAGATGTCACACAAGCATAAACTCGAGTTTATGCTTGTGTGACATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021397
VALIDATED
ZBTB32 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 32
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000444959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021397.2-1130s21c1
Sequence:CCGGATCTCACCAACACCCTCCTTTCTCGAGAAAGGAGGGTGTTGGTGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021397.2-169s21c1
Sequence:CCGGCTGATAGGTTGGTACAGTTAGCTCGAGCTAACTGTACCAACCTATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021397.2-855s21c1
Sequence:CCGGTTGTTGTGGCCCTCCAGATACCTCGAGGTATCTGGAGGGCCACAACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021397.2-691s21c1
Sequence:CCGGAGGTCATGCGAGGTATCGAGACTCGAGTCTCGATACCTCGCATGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096484    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021397.1-1459s1c1
Sequence:CCGGCTTGACAAAGAGTCCAAAGAACTCGAGTTCTTTGGACTCTTTGTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021397.1-962s1c1
Sequence:CCGGCAGATAGAAACGTCTGGGCAACTCGAGTTGCCCAGACGTTTCTATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021397.1-1123s1c1
Sequence:CCGGGCATCAGATGGAGACACATTACTCGAGTAATGTGTCTCCATCTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021397.1-421s1c1
Sequence:CCGGCCAGCAATCAGAAGACTTCATCTCGAGATGAAGTCTTCTGATTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021397.1-524s1c1
Sequence:CCGGGAGATGTCACACAAGCATAAACTCGAGTTTATGCTTGTGTGACATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014383
ZBTB32 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 32
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000413889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014383.1-286s21c1
Sequence:CCGGCCAGCACTCTGTGATACTCTGCTCGAGCAGAGTATCACAGAGTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014383.1-1021s21c1
Sequence:CCGGAGATATGGCATTCCCTTCTACCTCGAGGTAGAAGGGAATGCCATATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422674    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014383.1-1692s21c1
Sequence:CCGGCTTAGCCAAGAGTCCAATTAACTCGAGTTAATTGGACTCTTGGCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014383.1-836s21c1
Sequence:CCGGATGGAGTGCTCACGTGGTTGACTCGAGTCAACCACGTGAGCACTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014383.1-601s1c1
Sequence:CCGGCCAGAGAAACCCTCAAGGAATCTCGAGATTCCTTGAGGGTTTCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014383.1-426s1c1
Sequence:CCGGCCAGCTCCTGAACTTTGTGTACTCGAGTACACAAAGTTCAGGAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014383.1-781s1c1
Sequence:CCGGTCAAAGGAGAAACGCCTCCAACTCGAGTTGGAGGCGTTTCTCCTTTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014383.1-1090s1c1
Sequence:CCGGAGGATCCCACTGTCCCTAAATCTCGAGATTTAGGGACAGTGGGATCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014383.1-656s1c1
Sequence:CCGGAGAAACCAGAACAGGTTTCTACTCGAGTAGAAACCTGTTCTGGTTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014383
ZBTB32 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 32
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000413889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014383.1-286s21c1
Sequence:CCGGCCAGCACTCTGTGATACTCTGCTCGAGCAGAGTATCACAGAGTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014383.1-1021s21c1
Sequence:CCGGAGATATGGCATTCCCTTCTACCTCGAGGTAGAAGGGAATGCCATATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422674    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014383.1-1692s21c1
Sequence:CCGGCTTAGCCAAGAGTCCAATTAACTCGAGTTAATTGGACTCTTGGCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014383.1-836s21c1
Sequence:CCGGATGGAGTGCTCACGTGGTTGACTCGAGTCAACCACGTGAGCACTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014383.1-601s1c1
Sequence:CCGGCCAGAGAAACCCTCAAGGAATCTCGAGATTCCTTGAGGGTTTCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014383.1-426s1c1
Sequence:CCGGCCAGCTCCTGAACTTTGTGTACTCGAGTACACAAAGTTCAGGAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014383.1-781s1c1
Sequence:CCGGTCAAAGGAGAAACGCCTCCAACTCGAGTTGGAGGCGTTTCTCCTTTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014383.1-1090s1c1
Sequence:CCGGAGGATCCCACTGTCCCTAAATCTCGAGATTTAGGGACAGTGGGATCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014383.1-656s1c1
Sequence:CCGGAGAAACCAGAACAGGTTTCTACTCGAGTAGAAACCTGTTCTGGTTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014383
ZBTB32 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 32
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000413889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014383.1-286s21c1
Sequence:CCGGCCAGCACTCTGTGATACTCTGCTCGAGCAGAGTATCACAGAGTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014383.1-1021s21c1
Sequence:CCGGAGATATGGCATTCCCTTCTACCTCGAGGTAGAAGGGAATGCCATATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422674    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014383.1-1692s21c1
Sequence:CCGGCTTAGCCAAGAGTCCAATTAACTCGAGTTAATTGGACTCTTGGCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014383.1-836s21c1
Sequence:CCGGATGGAGTGCTCACGTGGTTGACTCGAGTCAACCACGTGAGCACTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014383.1-601s1c1
Sequence:CCGGCCAGAGAAACCCTCAAGGAATCTCGAGATTCCTTGAGGGTTTCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014383.1-426s1c1
Sequence:CCGGCCAGCTCCTGAACTTTGTGTACTCGAGTACACAAAGTTCAGGAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014383.1-781s1c1
Sequence:CCGGTCAAAGGAGAAACGCCTCCAACTCGAGTTGGAGGCGTTTCTCCTTTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014383.1-1090s1c1
Sequence:CCGGAGGATCCCACTGTCCCTAAATCTCGAGATTTAGGGACAGTGGGATCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014383.1-656s1c1
Sequence:CCGGAGAAACCAGAACAGGTTTCTACTCGAGTAGAAACCTGTTCTGGTTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks