EMAIL THIS PAGE TO A FRIEND

ZBTB33

zinc finger and BTB domain containing 33

Synonyms: ZNF-kaiso ZNF348
UniProtKB ID: Q86T24, B2R5U6, O00319, Q7Z361, Q8IVP6, Q8N3P0
Gene ID:
Human(10009) Summary: This gene encodes a transcriptional regulator with bimodal DNA-binding specificity, which binds to methylated CGCG and also to the non-methylated consensus KAISO-binding site TCCTGCNA. The protein contains an N-terminal POZ/BTB domain and 3 C-terminal zinc finger motifs. It recruits the N-CoR repressor complex to promote histone deacetylation and the formation of repressive chromatin structures in target gene promoters. It may contribute to the repression of target genes of the Wnt signaling pathway, and may also activate transcription of a subset of target genes by the recruitment of catenin delta-2 (CTNND2). Its interaction with catenin delta-1 (CTNND1) inhibits binding to both methylated and non-methylated DNA. It also interacts directly with the nuclear import receptor Importin-alpha2 (also known as karyopherin alpha2 or RAG cohort 1), which may mediate nuclear import of this protein. Alternatively spliced transcript variants encoding the same protein have been identified.[provided by RefSeq, May 2010]
Mouse(56805) zinc finger and BTB domain containing 33
Rat(501506) zinc finger and BTB domain containing 33
Zebrafish(562507) zinc finger and BTB domain containing 33
Horse(100062002) zinc finger and BTB domain containing 33
domestic cat(101086378) zinc finger and BTB domain containing 33
dog(100685062) zinc finger and BTB domain containing 33
chicken(422367) zinc finger and BTB domain containing 33
cow(784871) zinc finger and BTB domain containing 33
sheep(101112197) zinc finger and BTB domain containing 33
naked mole-rat(101708806) zinc finger and BTB domain containing 33
Domestic Rabbit(100348939) zinc finger and BTB domain containing 33
domestic guinea pig(100713178) zinc finger and BTB domain containing 33
166 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006777 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006777 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006777 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020256 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020256 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020256 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006777 Rosetta Predictions human pricing
NM_001109314 Rosetta Predictions rat pricing
NM_001079513 Rosetta Predictions mouse pricing
NM_020256 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006777 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199087 predicted 2041
2 SASI_Hs01_00199088 predicted 2236
3 SASI_Hs02_00342282 predicted 2128
4 SASI_Hs01_00199089 predicted 1494
5 SASI_Hs01_00199091 predicted 1802
6 SASI_Hs01_00199092 predicted 1553
7 SASI_Hs01_00199093 predicted 326
8 SASI_Hs01_00199095 predicted 384
9 SASI_Hs02_00342283 predicted 1795
10 SASI_Hs02_00342284 predicted 1328
11 SASI_Hs01_00199086 predicted 550
12 SASI_Hs01_00199090 predicted 1047
13 SASI_Hs01_00199094 predicted 1843
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109314 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247204 predicted 644
2 SASI_Rn02_00247205 predicted 1149
3 SASI_Rn02_00247206 predicted 1788
4 SASI_Rn02_00247207 predicted 2267
5 SASI_Rn02_00247208 predicted 526
6 SASI_Rn02_00247209 predicted 1505
7 SASI_Rn02_00247210 predicted 1499
8 SASI_Rn02_00247211 predicted 283
9 SASI_Rn02_00247212 predicted 919
10 SASI_Rn02_00247213 predicted 1689
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079513 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293002 predicted 1009
2 SASI_Mm02_00293003 predicted 2212
3 SASI_Mm02_00293004 predicted 398
4 SASI_Mm02_00293005 predicted 2143
5 SASI_Mm02_00293006 predicted 370
6 SASI_Mm02_00293007 predicted 904
7 SASI_Mm02_00293008 predicted 1666
8 SASI_Mm02_00293009 predicted 2009
9 SASI_Mm02_00293010 predicted 2024
10 SASI_Mm02_00293011 predicted 1569
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020256 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00171874 predicted 1187
2 SASI_Mm01_00171875 predicted 2381
3 SASI_Mm01_00171876 predicted 569
4 SASI_Mm01_00171877 predicted 2315
5 SASI_Mm02_00325437 predicted 550
6 SASI_Mm01_00171879 predicted 1071
7 SASI_Mm01_00171880 predicted 1842
8 SASI_Mm01_00171882 predicted 2185
9 SASI_Mm02_00325438 predicted 2197
10 SASI_Mm01_00171883 predicted 1742
11 SASI_Mm01_00171878 predicted 1722
12 SASI_Mm01_00171881 predicted 2166
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006777
VALIDATED
ZBTB33 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 33
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006777.3-751s1c1
Sequence:CCGGGCCGAAGATTATGAAATGAAACTCGAGTTTCATTTCATAATCTTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_006777.3-1539s1c1
Sequence:CCGGCGGTGAAGATACTTATGATATCTCGAGATATCATAAGTATCTTCACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006777.3-1799s1c1
Sequence:CCGGGCCGTTACTGTGAGAAGGTATCTCGAGATACCTTCTCACAGTAACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017838    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_006777.3-2600s1c1
Sequence:CCGGCCCTTCCATGTTAGCACTTTACTCGAGTAAAGTGCTAACATGGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006777.3-358s1c1
Sequence:CCGGCGGGCTCACAAGAATATTCTTCTCGAGAAGAATATTCTTGTGAGCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232209    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006777.3-3643s21c1
Sequence:CCGGGATTGTTGTGCATAGTTATTACTCGAGTAATAACTATGCACAACAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006777.3-1690s21c1
Sequence:CCGGGTAGATGGAAGGGTCTATTATCTCGAGATAATAGACCCTTCCATCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006777.3-1049s21c1
Sequence:CCGGCACATCTGACTCCCAATATTACTCGAGTAATATTGGGAGTCAGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006777.3-843s21c1
Sequence:CCGGGGAGACTTTGCCGAGTAATAACTCGAGTTATTACTCGGCAAAGTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006777
VALIDATED
ZBTB33 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 33
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006777.3-751s1c1
Sequence:CCGGGCCGAAGATTATGAAATGAAACTCGAGTTTCATTTCATAATCTTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_006777.3-1539s1c1
Sequence:CCGGCGGTGAAGATACTTATGATATCTCGAGATATCATAAGTATCTTCACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006777.3-1799s1c1
Sequence:CCGGGCCGTTACTGTGAGAAGGTATCTCGAGATACCTTCTCACAGTAACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017838    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_006777.3-2600s1c1
Sequence:CCGGCCCTTCCATGTTAGCACTTTACTCGAGTAAAGTGCTAACATGGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006777.3-358s1c1
Sequence:CCGGCGGGCTCACAAGAATATTCTTCTCGAGAAGAATATTCTTGTGAGCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232209    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006777.3-3643s21c1
Sequence:CCGGGATTGTTGTGCATAGTTATTACTCGAGTAATAACTATGCACAACAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006777.3-1690s21c1
Sequence:CCGGGTAGATGGAAGGGTCTATTATCTCGAGATAATAGACCCTTCCATCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006777.3-1049s21c1
Sequence:CCGGCACATCTGACTCCCAATATTACTCGAGTAATATTGGGAGTCAGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006777.3-843s21c1
Sequence:CCGGGGAGACTTTGCCGAGTAATAACTCGAGTTATTACTCGGCAAAGTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006777
VALIDATED
ZBTB33 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 33
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006777.3-751s1c1
Sequence:CCGGGCCGAAGATTATGAAATGAAACTCGAGTTTCATTTCATAATCTTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_006777.3-1539s1c1
Sequence:CCGGCGGTGAAGATACTTATGATATCTCGAGATATCATAAGTATCTTCACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006777.3-1799s1c1
Sequence:CCGGGCCGTTACTGTGAGAAGGTATCTCGAGATACCTTCTCACAGTAACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017838    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_006777.3-2600s1c1
Sequence:CCGGCCCTTCCATGTTAGCACTTTACTCGAGTAAAGTGCTAACATGGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006777.3-358s1c1
Sequence:CCGGCGGGCTCACAAGAATATTCTTCTCGAGAAGAATATTCTTGTGAGCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232209    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006777.3-3643s21c1
Sequence:CCGGGATTGTTGTGCATAGTTATTACTCGAGTAATAACTATGCACAACAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006777.3-1690s21c1
Sequence:CCGGGTAGATGGAAGGGTCTATTATCTCGAGATAATAGACCCTTCCATCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006777.3-1049s21c1
Sequence:CCGGCACATCTGACTCCCAATATTACTCGAGTAATATTGGGAGTCAGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006777.3-843s21c1
Sequence:CCGGGGAGACTTTGCCGAGTAATAACTCGAGTTATTACTCGGCAAAGTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020256
VALIDATED
ZBTB33 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 33
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020256.1-2352s1c1
Sequence:CCGGCGTGTTAATTTGATCTACCATCTCGAGATGGTAGATCAAATTAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020256.1-1560s1c1
Sequence:CCGGCGGTGAAGATACTTACAATATCTCGAGATATTGTAAGTATCTTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020256.1-1009s1c1
Sequence:CCGGCCTGTGAATCAGGCAACTCTACTCGAGTAGAGTTGCCTGATTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020256.1-1660s1c1
Sequence:CCGGCCACCAAACAAGCGTATGAAACTCGAGTTTCATACGCTTGTTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020256.1-1659s1c1
Sequence:CCGGGCCACCAAACAAGCGTATGAACTCGAGTTCATACGCTTGTTTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020256.2-1113s21c1
Sequence:CCGGCACATCTGACTCCTAACATTACTCGAGTAATGTTAGGAGTCAGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020256.2-607s21c1
Sequence:CCGGGCAGTTACTAGGCGTGAAATTCTCGAGAATTTCACGCCTAGTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020256.2-2199s21c1
Sequence:CCGGCAACGTTCTGGGAAGATATTTCTCGAGAAATATCTTCCCAGAACGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020256.2-1959s21c1
Sequence:CCGGCTTTCATCAACTATCAGTTTACTCGAGTAAACTGATAGTTGATGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020256.2-2599s21c1
Sequence:CCGGAGAATTACTGGAGTTACTAATCTCGAGATTAGTAACTCCAGTAATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020256
VALIDATED
ZBTB33 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 33
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020256.1-2352s1c1
Sequence:CCGGCGTGTTAATTTGATCTACCATCTCGAGATGGTAGATCAAATTAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020256.1-1560s1c1
Sequence:CCGGCGGTGAAGATACTTACAATATCTCGAGATATTGTAAGTATCTTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020256.1-1009s1c1
Sequence:CCGGCCTGTGAATCAGGCAACTCTACTCGAGTAGAGTTGCCTGATTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020256.1-1660s1c1
Sequence:CCGGCCACCAAACAAGCGTATGAAACTCGAGTTTCATACGCTTGTTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020256.1-1659s1c1
Sequence:CCGGGCCACCAAACAAGCGTATGAACTCGAGTTCATACGCTTGTTTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020256.2-1113s21c1
Sequence:CCGGCACATCTGACTCCTAACATTACTCGAGTAATGTTAGGAGTCAGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020256.2-607s21c1
Sequence:CCGGGCAGTTACTAGGCGTGAAATTCTCGAGAATTTCACGCCTAGTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020256.2-2199s21c1
Sequence:CCGGCAACGTTCTGGGAAGATATTTCTCGAGAAATATCTTCCCAGAACGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020256.2-1959s21c1
Sequence:CCGGCTTTCATCAACTATCAGTTTACTCGAGTAAACTGATAGTTGATGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020256.2-2599s21c1
Sequence:CCGGAGAATTACTGGAGTTACTAATCTCGAGATTAGTAACTCCAGTAATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020256
VALIDATED
ZBTB33 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 33
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020256.1-2352s1c1
Sequence:CCGGCGTGTTAATTTGATCTACCATCTCGAGATGGTAGATCAAATTAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020256.1-1560s1c1
Sequence:CCGGCGGTGAAGATACTTACAATATCTCGAGATATTGTAAGTATCTTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020256.1-1009s1c1
Sequence:CCGGCCTGTGAATCAGGCAACTCTACTCGAGTAGAGTTGCCTGATTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020256.1-1660s1c1
Sequence:CCGGCCACCAAACAAGCGTATGAAACTCGAGTTTCATACGCTTGTTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020256.1-1659s1c1
Sequence:CCGGGCCACCAAACAAGCGTATGAACTCGAGTTCATACGCTTGTTTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020256.2-1113s21c1
Sequence:CCGGCACATCTGACTCCTAACATTACTCGAGTAATGTTAGGAGTCAGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020256.2-607s21c1
Sequence:CCGGGCAGTTACTAGGCGTGAAATTCTCGAGAATTTCACGCCTAGTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020256.2-2199s21c1
Sequence:CCGGCAACGTTCTGGGAAGATATTTCTCGAGAAATATCTTCCCAGAACGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020256.2-1959s21c1
Sequence:CCGGCTTTCATCAACTATCAGTTTACTCGAGTAAACTGATAGTTGATGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020256.2-2599s21c1
Sequence:CCGGAGAATTACTGGAGTTACTAATCTCGAGATTAGTAACTCCAGTAATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks